• AgoraVox sur Twitter
  • RSS
  • Agoravox TV
  • Agoravox Mobile

Accueil du site > Tribune Libre > Le « Test » PCR est une énorme escroquerie sanitaire, très lourd de (...)

Le « Test » PCR est une énorme escroquerie sanitaire, très lourd de conséquences...


Le 27 novembre 2020, un groupe très respecté de plus de 20 virologues, microbiologistes et scientifiques du monde entier a publié un appel à Eurosurveillance pour retirer l'article du 23 janvier 2020 du "Dr" Christian Drosten, l'inventeur du dit "test" PCR. Leur analyse minutieuse de la pièce originale est accablante. Le leur est un véritable « examen par les pairs ». Ils accusent Drosten d'incompétence scientifique « fatale » et de failles dans la promotion de leur test.

Cet article ne met pas en cause la méthode PCR inventé par Kary Mullis mais ledit « test » PCR inventé par le « Dr » Christian DROSTEN.

Le « Test » PCR est une énorme escroquerie sanitaire, très lourd de conséquences, ... mise en place avec l’aide du « médecin » allemand « DR » Christian Drosten

Qu’est que signifié PCR ?

L’amplification en chaîne par polymérase (ACP, PCR en anglais, le sigle français étant rarement employé) ou réaction de polymérisation en chaîne (Polymerase Chain Reaction en anglais) est une méthode de biologie moléculaire d'amplification génique in vitro.

A la base PCR est une méthode et pas un test !

La méthode PCR été inventé par Kary Mullis en 1983, il est alors chercheur dans le domaine de la synthèse des oligonucléotides dans une petite entreprise de biotechnologies californienne, Cetus Corporation.

Il sera officiellement reconnu comme père de la PCR en 1993 lorsqu'il recevra, à 48 ans, le prix Nobel de chimie, « pour sa contribution au développement des méthodes pour la chimie de l'ADN et pour son invention de la PCR ». Il est décédé le 7 août 2019 avant la crise sanitaire du Covid-19.

Puis avec l’arrivé du Covid-19 un personnage clivant de la médecine allemande fait de nouveau parler de lui, le dit « Dr » Christian DROSTEN (virologue). C’est lui, qui en janvier 2020, a mis au point le test PCR du « Coronavirus » qui sert désormais de méthode standard dans le monde entier pour « détecter » le virus de la Covid-19.

Directeur de l’institut de la Charité à Berlin il est un conseiller très influent du gouvernement allemand et a participé en tant qu’expert a des nombreuses conférences de presse gouvernemental. Ainsi par ses analyses il a également influence de manière significative des décisions politiques de grande envergure, tel que le port obligatoire des masques, la suspension des cours régulier à l’école ou la fermeture de tout le secteur de la restauration, etc. !

Le scandale du coronavirus éclate dans l'Allemagne de Merkel. Faux positifs et test PCR Drosten
Le modèle allemand largement salué du régime d'Angela Merkel pour faire face à la pandémie de COVID-19 est maintenant englouti dans une série de scandales potentiellement dévastateurs allant au cœur même des tests et des conseils médicaux utilisés pour déclarer des fermetures économiques draconiennes et ensuite, vaccinations obligatoires de facto. Les scandales impliquent un professeur au cœur du groupe consultatif corona de Merkel. Les implications vont bien au-delà des frontières allemandes - jusqu'à l'OMS elle-même et ses recommandations mondiales.

L'ensemble des arguments en faveur du confinement d'urgence mandaté par l'OMS des entreprises, des écoles, des églises et d'autres arènes sociales dans le monde repose sur un test introduit, étonnamment tôt, dans la saga des coronavirus de Wuhan, en Chine.

Le 23 janvier 2020, dans la revue scientifique Eurosurveillance, du Centre européen de prévention et de contrôle des maladies, le « Dr » Christian Drosten, ainsi que plusieurs collègues de l'Institut de virologie de Berlin à l'hôpital Charité, ainsi que le chef d'une petite société de biotechnologie berlinoise, TIB Molbiol Syntheselabor GmbH, ont publié une étude affirmant avoir développé le premier test efficace pour détecter si une personne est infectée par le nouveau coronavirus identifié les premiers jours à peine à Wuhan. L'article de Drosten était intitulé « Détection du nouveau coronavirus 2019 (2019-nCoV) par RT-PCR en temps réel » (Eurosurveillance 25 (8) 2020).


La nouvelle a été immédiatement approuvée par le directeur général corrompu de l'OMS, Tedros Adhanom, le premier médecin non médical à diriger l'OMS. Depuis lors, le test de dépistage du virus soutenu par Drosten, appelé test en temps réel ou RT-PCR, s'est propagé via l'OMS dans le monde entier, en tant que protocole de test le plus utilisé pour déterminer si une personne pourrait avoir le COVID-19, la maladie.

Le dossier (tenu secret) Christian Drosten

Autre lien de la vidéo (en cas de censure)

Le 27 novembre 2020, un groupe très respecté de 
plus de 20 virologues, microbiologistes et scientifiques du monde entier a publié un appel à Eurosurveillance pour retirer l'article de Drosten, l'inventeur du dit "test" PCR, test du 23 janvier 2020. Leur analyse minutieuse de la pièce originale est accablante. Le leur est un véritable « examen par les pairs ». Ils accusent Drosten d'incompétence scientifique « fatale » et de failles dans la promotion de leur test.

Lettre de plus de 20 virologues, microbiologistes et scientifiques du monde entier

Pour commencer, comme le révèlent les scientifiques critiques, le document qui a établi le test Drosten PCR pour la souche de coronavirus de Wuhan qui a ensuite été adopté avec une hâte indécente par le gouvernement Merkel avec l'OMS pour une utilisation mondiale - ce qui a entraîné de graves confinements dans le monde et une catastrophe économique et sociale - n'a jamais fait l'objet d'un examen par les pairs avant sa publication par la revue Eurosurveillance. Les critiques soulignent que :

« L'article de Corman-Drosten a été soumis à Eurosurveillance le 21 janvier 2020 et accepté pour publication le 22 janvier 2020. Le 23 janvier 2020, l'article était en ligne.  »

Plus incroyable encore, le protocole de test Drosten, alors qu'il avait déjà envoyé à l'OMS à Genève le 17 janvier 2020, a été officiellement recommandé par l'OMS comme test mondial pour déterminer la présence du coronavirus de Wuhan, avant même que l'article ne soit publié.


Un court extrait du rapport traduit en français / voir le lien haut dessus :

Cet article montrera de nombreuses failles graves dans l'article de Corman-Drosten, dont l'importance a conduit à un diagnostic erroné dans le monde entier des infections attribuées au SRAS-CoV-2 et associées à la maladie COVID-19. Nous sommes confrontés à des verrouillages stricts qui ont détruit la vie et les moyens de subsistance de nombreuses personnes, l'accès limité à l'éducation et ces restrictions imposées par les gouvernements du monde entier constituent une attaque directe contre les droits fondamentaux des personnes et leurs libertés personnelles, entraînant des dommages collatéraux échelle globale.

Un autre co-auteur de l'article Drosten qui a donné une couverture de crédibilité scientifique apparente à la procédure de PCR Drosten était le chef de la société qui a développé le test commercialisé aujourd'hui, avec la bénédiction de l'OMS, par centaines de millions, Olfert Landt, de tib-MOLBIOL à Berlin, mais Landt n'a pas révélé ce fait pertinent dans le document Drosten.

Il serait pertinent de savoir si Drosten, le conseiller scientifique en chef de Merkel pour COVID-19, obtient un pourcentage sur les ventes de chaque test vendu par Tib-Molbiol dans leur accord de marketing mondial avec Roche.

Cycles d'amplification

L'OMS et Drosten recommandent un Ct de 45 cycles et, semble-t-il, actuellement, les responsables de la Santé allemands le font également. Il n'est pas étonnant que, alors que le nombre de tests augmente au début de la saison grippale hivernale, les « positifs » PCR en Allemagne et ailleurs explosent. Comme le soulignent les auteurs critiques, si les autorités sanitaires devaient spécifier 35 cycles maximum, selon l'article de Jaafar à l'IHU à 35 cycles, il ne resterait plus que 3% de vrais positifs ! Ils notent, « un résultat analytique avec une valeur Ct de 45 est scientifiquement absolument dénué de sens (une valeur Ct raisonnable ne doit pas dépasser 30). Tout cela doit être communiqué très clairement.

Ceci a été confirmé par un jugement d’un tribunal portugais :

Les juges du Portugal soulignent la fiabilité « plus que discutable » des tests COVID-19

En effet, ils citent une étude qui suggère que seulement 3% des tests positifs déclarés par les autorités sanitaires peuvent être de « vrais positifs ».

Une décision de 34 pages sur un appel contre un bref d’habeas corpus déposé par quatre touristes allemands « illégalement confinés » dans un hôtel aux Açores au cours de l’été ne laisse aucun doute sur le fait qu’un test RT-PCR positif ne peut être pris pour argent comptant.

Posez-vous la question pourquoi les médias mainstream français ne parlent pas du jugement du tribunal portugais au sujet des dites « tests » PCR ?

Toute cette escroquerie monumentale de la confiscation de nos libertés repose sur ce dit « test » PCR de Mr DROSTEN !

C'est une erreur importante que l'article de Corman-Drosten ne mentionne pas la valeur Ct maximale à laquelle un échantillon peut être considéré sans ambiguïté comme un résultat de test positif ou négatif. Cette limite de seuil de cycle importante n'est pas non plus spécifiée dans les soumissions de suivi à ce jour. Les auteurs ajoutent :

« Le fait que ces produits de PCR n'aient pas été validés au niveau moléculaire est une autre erreur frappante du protocole, rendant tout test basé sur celui-ci inutile en tant qu'outil de diagnostic spécifique pour identifier le virus SARS-CoV-2.  »

En clair, tout l'édifice de la fondation Gates, du gouvernement Merkel, de l'OMS et du WEF ainsi que le cas des vaccins de facto forcés non testés, repose sur les résultats d'un test PCR pour le coronavirus qui ne vaut pas une « cacahuète ». Le test de Drosten et de l'OMS est plus ou moins de la merde scientifique.


Une absence de preuve de son doctorat ?

Cette critique dévastatrice de vingt-trois scientifiques de premier plan, y compris des scientifiques titulaires de brevets liés à la PCR, à l'isolement et au séquençage de l'ADN, et d'un ancien scientifique en chef de Pfizer, est accablante, mais ce n'est pas le seul problème auquel le professeur Christian Drosten est confronté aujourd'hui. Lui et les fonctionnaires de l'Université Goethe de Francfort, où il affirme avoir obtenu son doctorat en médecine en 2003, sont accusés de fraude au diplôme. Selon le Dr Markus Kühbacher, un spécialiste enquêtant sur la fraude scientifique telle que le plagiat de thèse, la thèse de doctorat du Dr Drosten devait être déposée à une certaine date auprès des autorités académiques de son université, qui signent ensuite un formulaire juridique, « Revisionsschein », avec une signature authentique, un cachet de l'Université et la date, avec le titre de la thèse et l’auteur, afin qu’elle soit envoyée aux archives de l'Université. Trois exemplaires originaux de la thèse devraient y être déposés.

Kühbacher accuse l'Université de Goethe d'être coupable de dissimulation en affirmant, à tort, que le Revisionsschein (formulaire juridique) de Drosten était au dossier. Le porte-parole de l'université a ensuite été contraint d'admettre qu'il n'avait pas été déposé, du moins pas qui soit localisable par eux. De plus, sur les trois copies de dossier obligatoires de sa thèse de doctorat, très pertinent compte tenu de l'importance mondiale du rôle de Drosten dans la gestion de la crise de coronavirus, deux copies ont « disparu » et la copie unique restante est endommagée par l'eau. Kühbacher dit que Drosten va probablement faire face à des poursuites judiciaires pour un titre de doctorat frauduleux.

Avocat allemand Dr Reiner Fuellmich : Tests PCR ou le plus gros scandale de la médecine

Citation de l'avocat Dr Reiner Fuellmich :

« Nous nous concentrons sur les tests PCR car si nous parvenons à convaincre un tribunal qu’il s’agit d’une entreprise frauduleuse, c’est-à-dire le test PCR étant commercialisé avec l’affirmation qu’il peut détecter des infections, si nous pouvons convaincre le tribunal qu’il s’agit d’une fausse déclaration alors tout le château de cartes vas s’écrouler, car c’est le seul outil qu’ils utilisent pour garder les gens en mode panic ! Il n’y a aucun fondement à cette panique, parce-que comme je viens de le souligner, même selon l’OMS qui ne pouvait pas vraiment échapper aux conclusions de John Ioannidis, la mortalité ou la létalité est à peux-près la même que celle de la grippe commune. … Il y a déjà l’immunité collective, çà été une autre chose qui été négligé ! Il n’y aucune raison pour un vaccin, sauf pour que l’industrie pharmaceutique gagne de l’argent et cause probablement beaucoup de dégât en termes de santé … et il y aura probablement beaucoup de mort aussi parce que ses vaccins n’ont pas vraiment été testé correctement … généralement il faut entre 5 et 7 ans pour développer un nouveau vaccin »

Covid-19 : une étude accuse le confinement d'avoir aggravé la contagion

Cette étude, publiée le 5 janvier 2021, signée par un grand épidémiologiste à Stanford, établit que le confinement n’est pas d’une plus grande utilité que les gestes barrières.

Le confinement aurait-il aggravé la situation sanitaire ? Alors que le conseil de défense sanitaire se réunit ce vendredi pour décider de restrictions sanitaires potentiellement plus strictes, le journal Les Echos a rendu compte d’une étude publiée par le « European journal of clinical investigation », une revue scientifique, qui critique sévèrement l’impact du confinement.

Signée du professeur et épidémiologiste John Ionannidis, l’étude souligne que le confinement et la fermeture des lieux culturels, bars et restaurants n’a été d’aucune utilité. Il n’aurait pas eu d’impacts sur le nombre de cas de contaminations et c’est même tout l’inverse. L’effet escompté par le confinement n’est pas là, selon cette étude, comme le révèlent les chiffres analysés par l’équipe de John Ioannidis.

Le confinement a favorisé les contaminations à l’intérieur des foyers

Pour arriver à ces conclusions, l’équipe de John Ioannidis a mis en place un protocole. Parmi les 10 pays analysés par l’équipe : la France. Les scientifiques ont mis le nombre de contaminations dans l’hexagone - à partir du moment où le confinement a été déclaré- et les entreprises fermées, en face de celles de pays où le confinement n’a pas été prononcé. Comme cela a été le cas en Suède ou en Corée du Sud. Le résultat est sans appel. L’effet des mesures restrictives n’a presque pas apporté d’avantages en termes de contaminations.

En revanche, ce qui est certain, c’est que le confinement coûte très cher à l’économie française. Selon Capital qui se fait l’écho de l’AFP, un confinement d’un mois amputerait le produit intérieur brut d’environ un point. Ce serait 20 milliards que la France perdrait en l’espace de quatre semaines de restrictions strictes, avec la fermeture des entreprises.

Si l'enjeu n'était pas si mortel pour l'humanité, tout serait de nature à être considéré comme une comédie absurde. Le tsar de la santé mondiale, le chef de l'OMS (Organisation mondiale de la Santé) Tedros n'est pas un médecin mais il conseille le gouvernement Merkel sur les mesures COVID-19. L'OMS est pour sa part financée en grande partie par la fondation Gates.

Dans son CV est indiqué ( Docteur en philosophie (PhD.), Santé communautaire )

Le gouvernement Merkel utilise le test PCR de Drosten et Drosten comme un expert « avec beaucoup de sagesse » pour justifier d’imposer des mesures aux conséquences économiques les plus draconiennes hors temps de guerre. Son ministre de la Santé, Jens Spahn, est un ancien banquier qui n'a pas de diplôme de médecine, seulement un passage en tant que lobbyiste pour Big Pharma. Le chef du CDC allemand, appelé Institut Robert Koch, Lothar Wieler, n'est pas un virologue, mais un médecin animalier, Vétérinaire (Tierarzt).

Chritian DROSTEN et ses faux pronostics

1ère prévision de Christian Drosten de 2003 / SRAS

« Si l’épidémie ne peut pas être endiguée dans un avenir proche il pourrait y avoir de nouveau des nouveaux cas répétés de SRAS. Si les épidémies de cette maladie pulmonaire devaient se produire régulièrement dans certains pays cela pourrait avoir des graves conséquences pour leur économie. On ne peut s’attendre à un vaccin efficace avant au moins deux ans.  »

Evolution réelle :

Selon l’OMS depuis le début de l’épidémie dit du SRAS en 2003 il n’y eu que 8096 cas de SRAS dans le monde avec 774 décès. En Allemagne, 9 cas au total et pas un seul décès !

2ème prévision de Christian Drosten de 2009 / Grippe porcine

« La maladie est une infection virale générale grave, avec des effets secondaires beaucoup plus grave que ce qu’on peut imaginer du pire vaccin !  »

Bien qu’il n’y pas d’information fiable sur le nombre des cas, Mr Drosten a exhorté les gens à se faire vacciner contre la grippe porcine !

Développement réel :

L’épidémie prévue ne ce n’est jamais produite, néanmoins les vaccins ont été commandés par les gouvernements occidentaux pour un coût de plusieurs centaines de millions d’euros, mais la grande majorité de la population les a rejetés, malgré la recommandation urgente de Drosten. Entre autres, les vaccins ont causé des dommages bien plus grave que la grippe porcine elle-même !

Conclusion :

Les pronostics effrayants de Drosten qui visait toujours la solution standard de la vaccination se sont révélés être des mauvaises estimations fatales, qui ont entrainé des dommages économiques gigantesques.

Comment est-il possible que Drosten avec ses pronostics d’horreur répétée continue d’apparaitre crédible comme le conseiller du gouvernement ?

Durant mes recherches sur internet j’ai trouvé un organe de presse qui avait commencé timidement à mettre en cause le dit « test » PCR

Votre test PCR est positif ? Cela ne signifie pas nécessairement que vous êtes porteur du Covid-19, ni contagieux

Les personnes asymptomatiques ne sont pas transmettrices du Covid-19. Les mesures de distanciation sociale se basent sur la fausse affirmation que les personnes asymptomatiques soient potentiellement transmettrices du Virus Covid-19 !

Les médias ont alimenté une phobie chez des gens qui croient maintenant que tout personne est un danger pour l’autre ! Distance au moins 2 mètres !!! Mais quelle folie !

C’est seulement quand le virus Covid-19 réussit à pénétrer les cellules que la personne devient transmettrice et c’est à ce moment-là que les premiers signes se présentent chez les gens infectés. C’est à ce moment que les personnes contagieuses devront passer en quarantaine, porter un masque, mais pas les gens en bonne santé !

Les tests PCR de dépistage du coronavirus, ceux où l’on fait un prélèvement dans la gorge et le nez, seraient-ils trop sensibles. Un peu partout dans le monde comme aux Etats-Unis, des voix s’élèvent parmi des experts de santé publique et des virologues, pour remettre en question cette méthode.

Pour comprendre cette escroquerie il faut s’intéresser de plus près à ce médecin allemand qui devrait être traduit en justice pour crime contre l’humanité avec toutes ses conséquences que lui et ses complices, car il n’opère pas seul, ont déclenché ! Mr DROSTEN est dans le viseur de l’avocat allemand Dr Reiner Fuellmich.

Dans la vidéo suivante (en allemand), l'avocat Dr Reiner Fuellmich mentionne le nom de l'avocat français Jean-Luc Duhamel qui mène des procès en France mais pas en recours collectif ( 29:06 )

Une plainte, action de nullité, sera également déposée, sur la base d'une coopération internationale, dans les semaines à venir, contre la Commission européenne pour avoir autorisé la mise sur le marché des vaccins ARN, considérés comme expérimentation génétique ! 30:50

Un noyau dur d'environ 50 Avocats dans le monde coopérant actuellement pour stopper cette escroquerie des "tests" PCR ! ( 31:25 )

( 32:15 ) En Septembre 2020 le CDC (Center for Desease Control) l'équivalent du RKI en Allemagne ... avait déjà mentionné dans le passé que si un test PCR est positif cela ne signifie pas forcément la présence d'un virus infectieux. A l'époque le CDC avait déjà dit qu'un test purement positif ne peut pas dire s'il existe une infection !!!
Toujours selon le CDC avec le test (PCR) on ne peut pas exclure, malgré un test positif, s'il s'agit d'un autre agent pathogène qui a provoqué les symptômes. Ceci a été confirmé par Dolores Cahill qui avait étudié, par séquençage, 1500 tests PCR positif "Covid-19" aux Etats-Unis pour savoir de quoi il s'agit et aucun virus Covid-19 parmi ses tests n'a été détecté. Tous les tests étaient soit influença A soit influença B !!!

Ceci laisse présumer qu'il s'agit d'une vague normale de grippe, comme ç'était déjà le cas avec la grippe porcine, ou les résultats ont été réétiqueté en pandémie, mais il peut aussi s'agir d'expériences avec d'autres virus, possiblement des armes biologiques, des expériences menées à Wuhan et qui ont conduit à une fuite des virus, mais quoi qu'il en soit, cela ne change rien au résultat, ce qui est confirmé par l'OMS (WHO en anglais). La dangerosité de ce virus qu'il soit partiellement artificiel ou pas n'est pas plus grande que celle d'une grippe normale ! Le taux de mortalité se situe à 0,14% parmi les personnes infectées, taux qui s'avoisine à celle d'une grippe ordinaire.

Les raisons du recours collectif international contre les fabricants du test PCR

La commission d’enquête extra-parlementaire allemande sur la COVID-19 lance un recours collectif contre les criminels du Coronavirus et pas seulement contre les politiques des gouvernements et leurs conseillers, mais aussi directement contre les fabricants.

« Le PCR – Polymerase Chain Reaction est une technique utilisée pour « amplifier » de petits segments d’ADN qui, selon de réputés virologues du monde entier, est absolument inadapté pour dépister la COVID-19.

Un test PCR positif ne signifie pas avec certitude que vous êtes malade ou contagieux et ne justifie donc en rien votre isolement, c'est à dire l'assignation à résidence en ce qui concerne les gens en bonne santé.

Quand on « confine » les gens en bonne santé cela porte le nom assignation à résidence, ce qu’est une mesure liberticide qui doit être réservée aux malfaiteurs qui ont été auparavant jugé par un tribunal  !

Pour transmettre la maladie, vous devez héberger le virus entier, son génome complet et l’excréter. Or le test met en évidence non pas le virus capable de se reproduire, mais simplement des fragments de son ARN qui ne sont en aucun cas infectieux. Ce test manque donc souvent de spécificité en particulier lorsqu’il ne recherche qu’un marqueur (les chinois en recherchent 5 à 6).

Néanmoins, le test PCR a été et est toujours vanté et promu par l’OMS – et par d’autres institutions sanitaires de premier plan dans le monde occidental, comme le NIAID / NIH et le CDC des États-Unis, ainsi que par des chercheurs du Centre allemand de recherche sur les infections (DZIF) à l’hôpital Charité de Berlin. » il est utilisé en France comme la panacée.

La taille du marché mondial du diagnostic COVID-19 est évaluée à 19,8 milliards de dollars en 2020.

Coup double
 : aubaine politique pour les gouvernements qui souhaitent imposer des lois anti démocratiques (interdiction de se réunir et/ de manifester) et pactole commercial avec des centaines de millions de tests vendus par le monde.

De plus, la panique entretenue par les médias pousse beaucoup de personnes à se faire tester plusieurs fois (et peuvent également être comptabilisées X fois).
Les nombre de « cas » sont ainsi multipliés et instrumentalisés

Le Dr Reiner Fuellmich, avocat de l’ACU, (Außerparlamentarischer Corona Untersuchungsausschuss ou ACU) explique dans sa première vidéo d’octobre 2020 comment le recours collectif pourrait mettre un terme à ces mesures destructrices et les inverser en dédommageant les personnes lésées et les petites et moyennes entreprises qui n’ont eu d’autre choix que de déclarer faillite et de licencier leurs employés.[vidéo en allemand sur odysee.com]

D’autres procès, recours collectifs, avec la collaboration internationales des avocats, pour dénoncer le détournement frauduleux de la technique PCR sont en préparation voire ont été lancés dans d’autres pays, Allemagne, États-Unis (New York), Canada, Australie, 3 collègues avocats du Dr Fuellmich à Israël font une étude pour voir s'ils vont attaquer les responsables en Allemagne..., Italie, France*, etc.

* Dans la vidéo suivante (en allemand) l'avocat Dr Reiner Fuellmich mentionne le nom de l'avocat français Jean-Luc Duhamel mais il ne s'agit pas un recours collectif ! ( 29:06 )

Le pire reste à venir, car les « vaccins » ARN dit anti-Covid-19 sont soupçonnés de fragiliser le système immunitaire permettant de créer la base pour le surgissement des vraies pandémies dans un proche avenir.

Imaginez-vous la catastrophe qui va arriver avec des centaines de millions de gens vaccinées et ayant leur système immunitaire fragilisé, surtout avec le personnel médical qui figure en haut de la liste des personnes ayant droit au « vaccin » ARN !

Dans la vidéo suivante le DR Simone Gold utilisé l’expression suivante à (18:40)

«  …cette facilitation de l’infection par des anticorps potentielle ... »

Dr Simone Gold : hydroxychloroquine et Vaccin Experimental

Les fabricants ont conclu l’année dernière, en 2020, un contrat avec l’UE pour se décharger de leur responsabilité pour des affects secondaires.


La chaîne allemande Kla.TV à nouveau bloquée sur Youtube

Voilà le système emploi tous les moyens pour éviter que la vérité sur cette escroquerie monstrueuse soit portée à la connaissance des français, car rendant toutes les mesures liberticides caduques, décrédibilisant les médias mainstream pour leur manque d’investigation, sans parler de l’aveuglement du dit conseil scientifique voire ses conflits d’intérêts ! Des nombreux médecins, professeurs, scientifiques, etc. qui ne partagent pas la vision du dit conseil scientifique français sont censurés, ce qui est un autre scandale dans le scandale !

Le 24 décembre 2020, jour symbolique s’il en est, Le gouvernement s’est attaqué à la liberté d’expression des médecins en publiant un décret modifiant l’Article R. 4127-19-1 du code de santé publique afin d’interdire aux médecins d’exprimer des opinions divergentes de la doxa officielle (celle entérinée par le conseil de l’Ordre des médecins).

Triste France, pays où on ne tolère plus que les gens, voire même les médecins s’expriment librement, ou le pouvoir s’attaque, OUI, même aux médecins, qui eu aussi doivent passer par des médias libres pour pouvoir s’exprimer.

On se retrouve soudainement projeté des centaines d’années en arriéré ou Galilée avait découvert et annoncé que la terre est ronde et étant obligé de se rétracter pour sauver ça vie face à aux inquisiteurs. Il est condamné en 1633 à un emprisonnement indéfini et demeure en résidence surveillée jusqu’à sa mort en 1642.

Notre médecine est la victime d'une dérive totalitaire... et détournée au profit des gens qui veulent une fois pour toutes, l'occasion Covid-19 ainsi la panique soutenue par les médias mainstream est trop belle, confisquer définitivement toutes nos libertés fondamentales !

Ne restez plus passif et aidez-nous de mettre un terme à cette gestion catastrophique et liberticide de cette crise volontairement amplifiée et réposant sur des faux chiffres voire mal interprétés !
Informez votre entourage !

Oui, c'est un véritable HULD-UP par l'oligarchie, par Big-Pharma sur nos libertés essentielles qui se réunit chaque année à Davos pour prendre des décisions leur ayant permis, au fil du temps, de prendre progressivement de plus en plus de contrôle sur les hommes politiques, au grand bénéfice de leurs profits juteux et croissants, ceci aux dépens des populations du monde.

Je souhaite terminer cet article par une vidéo, témoignage d'un citoyen ordinaire exprimant la souffrance que nous vivons, un témoignage vrai, un témoignage auquel Macron et ses acolytes sont insensibles et répondent par l'arrogance et le mépris envers les français ordinaires en nous imposent des mesures plus folles les unes que les autres, en dépassant largement la limite de l'insupportable.


Ps. : La dernière vidéo du Dr Reiner Fuellmich (en allemand, non traduite en français pour le moment)

Moyenne des avis sur cet article :  4.46/5   (52 votes)

Réagissez à l'article

131 réactions à cet article    

    • Garibaldi2 2 février 02:46


      LE test PCR pour détecter la covid ?

      Il y a un tas de labos qui ont développé un test PCR pour détecter ce virus. Par exemple l’institut Pasteur (extraits) :

      ’’Dans le cadre de la crise liée à la Covid-19, et dès l’apparition des premiers cas à l’international, et plus particulièrement en Europe (fin janvier 2020), le CNR de l’Institut Pasteur a développé un test de diagnostic permettant de détecter la présence du virus SARS-CoV-2 (à l’époque appelé nCoV-19) lors de suspicion de cas infectés


      Le CNR a développé deux tests RT-PCR, respectivement IP2 et IP4, dans le cadre de l’épidémie de Covid-19. Ces deux tests utilisent chacun trois séquences distinctes du génome du SARS-CoV-2. Il s’agit de deux séquences « amorces » qui permettent l’amplification d’une courte séquence du génome du virus et d’une séquence « sonde » qui permet la détection en venant se fixer sur les séquences amplifiées à l’aide des deux amorces. Il faut donc une correspondance du matériel génétique dans le prélèvement avec les trois séquences simultanément pour obtenir un résultat positif. Si l’une de ces trois séquences ne se fixe pas, aucun signal n’est détecté, le résultat est négatif.

      Dans le cadre du test IP2, les trois séquences sont :

      - « CTCCCTTTGTTGTGTTGT » et « ATGAGCTTAGTCCTGTTG » qui comptent respectivement 18 et 17 nucléotides (ce sont les deux séquences amorces)
      - et la séquence « AGATGTCTTGTGCTGCCGGTA [5’]Hex [3’]BHQ-1 qui compte 21 nucléotides (elle correspond à la séquence sonde).

      Le génome complet du SRAS-CoV-2 comprend un enchaînement de 30 000 bases, et celui du génome humain, 3 milliards. Comme le code génétique ne comporte que 4 bases (A, T, C, G), il arrive parfois que de petites séquences de nucléotides se retrouvent dans différents organismes, comme c’est le cas pour la séquence « CTCCCTTTGTTGTGTTGT ». En effet, l’homme mais aussi d’autres espèces animales comme le labrador retriever, le chat, le cochon… possèdent cette séquence dans leur génome.

      Par contre, l’association des trois séquences est unique au SARS-CoV-2 et c’est cette singularité qui permet l’identification du virus dans les tests.’’

      L’article complet est sur : https://www.pasteur.fr/fr/espace-presse/documents-presse/fonctionnement-fiabilite-tests-rt-pcr-detection-du-sars-cov-2

    • Garibaldi2 2 février 03:15


      Donc, votre affirmation : ’’Puis avec l’arrivé du Covid-19 un personnage clivant de la médecine allemande fait de nouveau parler de lui, le dit « Dr » Christian DROSTEN (virologue). C’est lui, qui en janvier 2020, a mis au point le test PCR du « Coronavirus » qui sert désormais de méthode standard dans le monde entier pour « détecter » le virus de la Covid-19.’’ est erronée ou mensongère.

      Il ne vous reste plus qu’a corriger votre article.

    • Garibaldi2 2 février 03:38


      Vous écrivez :

      ‘’Un autre co-auteur de l’article Drosten qui a donné une couverture de crédibilité scientifique apparente à la procédure de PCR Drosten était le chef de la société qui a développé le test commercialisé aujourd’hui, avec la bénédiction de l’OMS, par centaines de millions, Olfert Landt, de tib-MOLBIOL à Berlin, mais Landt n’a pas révélé ce fait pertinent dans le document Drosten.’’

      Vous devriez lire les sources que vous mentionnez, car dans le document en ligne :


      Il est clairement indiqué en fin de document à la rubrique :

      ‘’Conflict of interest**’’

      que :

      ‘’Olfert Landt is CEO of Tib-Molbiol ; Marco Kaiser is senior researcher at GenExpress and serves as scientific advisor for Tib-Molbiol.’’.

      Il ne vous reste plus qu’à corriger votre article.

    • @Garibaldi2

      ca paye bien ? Parce que la franchement tu te defonce pour reinformer les idiot qui ne regarde plus la tv ...

      pas trop dur ? jamais de burnout devant l’ ampleur de cette tache ingrate ?

    • eau-du-robinet eau-du-robinet 2 février 08:31

      Écoutez le passage de cette vidéo à partir de 0:25s
      J’attends vos excuses !

    • eau-du-robinet eau-du-robinet 2 février 08:43

      La mention :
      Conflict of interest**

      Olfert Landt is CEO of Tib-Molbiol ; Marco Kaiser is senior researcher at GenExpress and serves as scientific advisor for Tib-Molbiol.

      figure effectivement dans le document cité.
      Je confirme ainsi cette erreur dans mon article.
      Cela n’empêche par contre pas les conflits d’intérêts d’Olfert Landt.
      Mes excuses pour cette erreur. smiley

    • eau-du-robinet eau-du-robinet 2 février 09:17

      « L’article complet est sur : https://www.pasteur.fr/fr/espace-presse/documents-presse/fonctionnement-fiabilite-tests-rt-pcr-detection-du-sars-cov-2 »

      Je vous remercie d’avoir fait partager cette information datent du 16.11.2020

      Les séquences de Drosten ont été publié le 23.01.2020 et elles sont différentes de celles de l’institut Pasteur . 
      Au sujet de l’institut Pasteur une courte vidéo à regarder

    • Garibaldi2 2 février 10:47


      Comment pouvez-vous tenir pour crédible un site piloté par Ivo Sasek, qui est le fondateur de ’’la coalition anti-censure’’ (AZK). C’est cette organisation qui a invité à Coire (Suisse), en novembre 2012 à son 8ème congrès, l’avocate négationniste Sylvia Stolz  : https://www.20min.ch/fr/story/negationniste-condamnee-pour-un-discours-a-coire-910931140628

      Lisez ce que pense de lui le portail catholique suisse :https://www.cath.ch/newsf/appenzell-mise-en-garde-contre-une-comedie-musicale-du-suisse-ivo-sasek/

    • Ben Schott 2 février 10:57

      Et alors ? Tu as bien vérifié qu’il n’a pas en plus un berger allemand qui descend en droite ligne de celui du Docteur Mengélé, ce qui aggraverait son cas, bien entendu ?

    • Garibaldi2 2 février 11:00


      La date de l’article ce n’est pas la date des recherches de Pasteur qui ont commencé dès janvier 2020.

      Sur les nanoparticules : comment pouvez-vous croire de pareilles sottises qui ont déjà été ’’débunkées’’ ici :

      https://www.bmj.com/content/356/bmj.j596/rr-0 !

    • eau-du-robinet eau-du-robinet 2 février 11:27

      "Sur les nanoparticules : comment pouvez-vous croire de pareilles sottises

      ... ?"

      Information de l’institut Pasteur :

      Développement d’un nouveau nano-vaccin à multiples épitopes contre le coronavirus SARS-CoV2 et création d’un modèle de souris humanisé pour tester ce vaccin

      il est marque :
      Objectif : Cette étude cherche à générer une réponse immunitaire protective anti-SARS-CoV2 dans un modèle de souris humanisées. Cette immunisation sera effectuée grâce à l’administration de nanoparticules portant les épitopes immunogéniques dominants du virus SARS-CoV2, reconnus par les cellules B et T. La liaison de ces cellules immunitaires avec les peptides viraux sera prédite grâce au serveur EpiDOCK.

    • eau-du-robinet eau-du-robinet 2 février 11:35

      Suite nanoparticules :
      La composition du vaccin Pfizer- BioNTech dévoilée
      citation :
      Le saccharose sert de conservateur. Il permet aussi, pendant la congélation à — 70 ou — 80°C du vaccin, aux nanoparticules de se coller entre elles.

    • eau-du-robinet eau-du-robinet 2 février 12:42

      Bonjour bouffon(s) du roi,
      Merci pour ce lien smiley
      Ses gens qui développent ses saloperies sont vraiment des malades !

    • eau-du-robinet eau-du-robinet 5 février 07:47

      Un élément inquiétant qui c’est déroulé fin janvier 2021 à l’assemblé nationale :
      La suppression de la commission d’information Covid-19

    • eau-du-robinet eau-du-robinet 5 février 08:05

      Au sujet de la :
      La suppression de la commission d’information Covid-19

      Je supposé que le but recherché de la suppression de la commission est de ne pas tenir la population française informé sur les effets secondaires de la vaccination !
      Une mesure similaire à été prise en Allemagne ou les pharmaciens et d’autres gens du secteur médicaux ont reçu une lettre des autorités de ne pas informer les gens sur les vaccins !!!!

      Source de l’information d’une vidéo en allemand (passage à partir de 1:25:32) témoignage d’une psychothérapeute.

      « Wir werden ganz eindeutlich aufgefordert nicht aufzuklären .... Wir sollen über die Impfung nicht aufklären ! »

      « On nous demande clairement de ne pas informer les gens ... On ne doit pas informer les gens sur la vaccination »

      Sachez qu’il existe des alternatives à la vaccination ce que les autorités sanitaires, le professeur Salomon, Karine Lacombe, etc. avait démenti depuis le début de la dite crise sanitaire Covid-19

    • eau-du-robinet eau-du-robinet 7 février 21:20

      Absolument à écouter ce témoignage frappent :

      Un exemple extrait du discours de Martine Wonner devant les parlementaires :

      « La société française de pédiatrie nous alerte pourquoi ?
      Aujourd’hui ils voient arriver aux urgences pédiatrique / psychiatrique des gamins de 9 ans, 10 ans qui font des tentatives de suicide ! C’est absolument du jamais vue ! »
      Martine WONNER - Interventions - Projet de loi prorogation de l’état d’urgence sanitaire 02/02/21

    • eresse eresse 7 février 22:26

      peut importe le test, les séquences sont aussi valables que d’autres.
      Le problème porte sur le CT, c’est a dire le nombre d’amplifications que vous effectuez, et ainsi de savoir si vous avez amplifié un virus actif ou un brin de virus inactif, ce qui au final n’est pas la même chose.

    • eau-du-robinet eau-du-robinet 7 février 22:34

      Bonjour eresse,
      "peut importe le test, les séquences sont aussi valables que d’autres.
      Le problème porte sur le CT, c’est a dire le nombre d’amplifications que vous effectuez, et ainsi de savoir si vous avez amplifié un virus actif ou un brin de virus inactif, ce qui au final n’est pas la même chose.
      +++++ smiley

    • eau-du-robinet eau-du-robinet 8 février 09:12

      Vous pouvez lire le jugement complet en portugais ici, et traduit en anglais ici. Il y a aussi un bon article sur le Great Game India, et un professeur portugais a envoyé un long e-mail sur l’affaire à Lockdown Scpetics.

      • Opposition contrôlée Opposition contrôlée 1er février 13:23

        Directeur de l’institut de la Charité à Berlin

        Bah, c’est les mêmes qui ont trouvé du novitchok chez Navalny il me semble. C’est des chercheurs qui trouvent ce que les politiques demandent qu’on trouve. Cependant d’après Raoult, la validité du test dépend du cycle d’amplification, et effectivement il dit que 45 est hors limite.

        • sirocco sirocco 1er février 14:07

          "Le pire reste à venir, car les « vaccins » ARN dit anti-Covid-19 sont soupçonnés de fragiliser le système immunitaire permettant de créer la base pour le surgissement des vraies pandémies dans un proche avenir."


          Le JT de France 2 hier soir 31 janvier à 20:00, que j’incite tout le monde à voir en replay, nous apprend que le pseudo-vaccin Pfizer-BioNTech contient bien des nanoparticules qui sont élaborées par un laboratoire spécialisé en Europe.


          Que font ces agents troubles dans un « vaccin » ? Quelle est exactement leur « mission » ? Là on n’en sait strictement rien et si des « scientifiques » officiels nous proposent une réponse lénifiante, nous serons fondés à rester extrêmement suspicieux...

          • Le Panda Le Panda 1er février 14:09

            eau-du-robinet, bonjour

            A la lecture je suis stupéfait, je me pose une seule question. Sommes-nous face à « Awacs » de taille internationale ou bien c’est la gag du siècle ? L’article ne porterait pas votre « pseudo » que je n’aurai pas même prit le soin de poser un commentaire. C’est comme si l’on disait « Tous les morts de La Covid c’est une Grande Illusion » 


            Le Panda

            • eau-du-robinet eau-du-robinet 1er février 14:28

              @Le Panda
              Les morts sont bien réelles mais une grande partie de ses morts ne sont pas mort du au Covid-19 mais avec le Covid-19. L’interdiction / restriction de l’usage de l’hydroxychloroquine et d’autres médicaments a contribué à alimenter les statistiques des morts du au Covid-19, etc...
              C’est quand même bizarre quand un accidenté de route rentre en clinique et meurt deux heures plus tard qu’il est ajouté dans les statistiques des morts du Covid-19. Je attendu que les médecins sont mieux rémunéré en cochent la case « mort du Covid-19 » ... ceci reste à vérifier ... !

            • Le Panda Le Panda 1er février 14:39


              Je suis réellement quitte à me répéter que je n’y crois pas. En ma qualité d’ex chercheur n, à la retraite depuis 5 ans, « j’ai aidé » dans les service de Covid, et réanimations ; nous serions sur une situation au-delà du scandale d’état. Ayant exercé pendant 28 ans et étant passé à Pasteur et à La Salpêtrière jamais je n’ai reçu une somme quelconque sous prétexte ; d’avoir déclaré « Un décès du S.I.D.A. » Il faut avoir la dignité lorsque l’on prête « Serment » Merci de m’avoir répondu.

              Le Panda

            • sirocco sirocco 1er février 15:22

              @Le Panda

              « Il faut avoir la dignité lorsque l’on prête « Serment »

              Sans mettre en doute votre bonne foi, il est temps de réaliser que les mentalités ont beaucoup évolué en France depuis votre époque, généralement pas en bien, surtout sous le régime de Macron.

              Les flics aussi prêtent »serment" et on voit ce que ça donne lors des enquêtes ou des procès....

            • Le Panda Le Panda 1er février 15:31

              Je vous remercie de votre réaction, mais je suis allé récemment à l’hôpital de ma ville et je n’ai jamais vu cela. On ne peut imputer à Macron les causes de la Covid, par contre que ce dernier soit « un incompétent » en gestion dans divers domaines, là je partage votre opinion. Quant aux flics ils sont bien souvent à l’image de leur ministre et je pense avoir tout dit avec cela.

              Le Panda

            • robert 1er février 16:28

              @Le Panda
              Bonjour, vous avez aidé dans des services covid il y a plus de 5 ans ?

            • Le Panda Le Panda 1er février 16:39

              Lorsque l’on ne sait lire en se tait ! Tous les professionnels de santé même à la retraite ont donné de leurs temps et de leurs connaissances, dans le cadre de la Covid, nous vivons avec des « coronavirus » depuis des siècles.
              Le Panda 

            • robert 1er février 16:43

              @Le Panda
              Quelle agressivité !
              Depuis des siècles ?

            • Le Panda Le Panda 1er février 16:56

              Il faut apprendre à utiliser « les moteurs de recherche » et il n’y a aucune agressivité dans mes propos, pensez-vous que je sois « ignorant » De la peste noire au Covid-19 en passant par la grippe espagnole ou Ebola, nos sociétés ont souvent été traversées par des crises sanitaires, comme nous le rappelle l’historienne Anne Rasmussen dans cet entretien. Lien 
              Il faut s’informer à mon modeste avis c’est la meilleure « prévention » qu’il existe en période de « pandémie » 
              Le Panda

            • eau-du-robinet eau-du-robinet 1er février 16:57

              Bonjour Le Panda,
              « On ne peut imputer à Macron les causes de la Covid ».
              Du Covid-19 non mais de la gestion irresponsable de la crise sanitaire OUI !
              Le gouvernent a exclus les médecins généralistes du combat contre le Covid19.
              Ils ont banni / diabolisé l’hydroxychloroquine. Les médecins généralistes ont un rôle primordial à jouer en début de maladie et on les a empêché en limitant leurs actions.
              Ils ont réservé l’hydroxychloroquine pour les gens mourants or c’est durant apparition des premières symptômes que le virus doit être combattu par exemple avec l’Hydroxychloroquine en combinaison avec la prise du zinc.
              Résultat de l’exclusion des médecins généralistes : Les cliniques débordent de malades GRAVES ... et pas que depuis hier.

              Voyons ce que c’est passé les années précédentes à la même période d’année, proche de l’arrivé de l’hiver, dans les hôpitaux françaises !

              Voyons ce que c’est passé depuis que vous êtes en retraite :
              Regardez des extraits des séquences vidéos prépositionné par année :
              2015 - saturation des lits des hôpitaux
              2016 - saturation des lits des hôpitaux

              2017 - saturation des lits des hôpitaux
              2018 - saturation des lits des hôpitaux

              2019 - saturation des lits des hôpitaux

              Et la prévention par la vitamine D (D3), le ZINC (oligoélément), la vitamine C, etc.
              Rien à été fait de la part du gouvernement. BI-ORTHOX voire AZINC, EGRY D Plus, ... Aucune prévention par le renforcement du Système immunitaire !!!
              Ils ont tout fait pour que cela dégénère, c’est voulu pour avancer leur agenda du Nouvel Ordre Mondial, pour empêcher les manifestations, etc. ...
              Le changement est partout, aussi dans la police !
              Écoutez ce témoignage :
              Ils ont osé d’interner le Prof. Fourtillian en psychiatrie, on traite le Pr. Raoult de Charlatan, idem pour le Pr Christian Perronne, etc.
              Ouvrez les yeux ! Le monde à beaucoup changé en seulement quelques années !
              27 manifestants pacifiques Gilets Jaunes éborgnées par la police qui est devenue une milice, et c’est même reconnue par la police !!!
              les ordres viennent d’en HAUT comme le policier dit !!!

            • Le Panda Le Panda 1er février 17:24

              Nous disons exactement la même chose, mais je suis presque persuadé en restant dans le cœur de l’article que nous allons tout droit vers un confinement de taille. Vous vous doutez bien que le contexte de la gestion du milieu hospitalier, je l’a connais Macron n’a fait qu’aggraver ce qu’Hollande, Sarkozy et Cie ont laissé pour compte. Vous savez comme moi que par les temps qui courent pas de comptes se règlent par « services interposés »
              Merci de tous vos liens

              Le Panda 

            • gnozd gnozd 1er février 19:32

              @Le Panda

              Comme vous y allez ! La peste noire. Bigre. Ebola ? Fichtre. Et pourquoi pas la bourbouille des pays chauds ou le béri-béri ?

              La peste noire, en un an, elle aurait déjà dézingué au bas mot 2 milliards de pékins !

              Petite anecdote : mon médecin traitant, qui exerce dans un centre médical (Pyrénées Orientales), me raconte le mois dernier que sa consoeur immédiate, celle qui bosse dans le cabinet d’à côté, est appelée pour un papy qui a fait un avc.
              Elle se déplace mais le temps d’arriver la personne est décédée et le samu, prévenu manifestement avant la toubib, a déjà, contre toute autorisation légale, rédigé le certificat de décès avec mention, devinez quoi, « COVID 19 » !!!

              Elle leur demande pourquoi ils ont marqué ça, ce à quoi ils lui répondent « on nous demande de marquer ça ». ON nous demande...C’est pas incroyable ? ON nous demande...
              Ceci est arrivé dans les P-O courant décembre. Et mon médecin traitant, c’est pas un complotiste, et sa collègue non plus.

              Voilà où nous en sommes. Ma belle-soeur infirmière à Perpignan m’a également confirmé avoir été témoin de ce genre de choses dans la structure où elle travaille.

              Excusez moi de ne pas donner plus de précisions géographiques, mais j’imagine que vous comprenez tous pourquoi, j’ai pas envie qu’elle perde son boulot ou que mon médecin traitant se retrouve interdit d’exercer...

            • GoldoBlack 1er février 19:48

              « depuis 5 ans »
              « depuis des siècles »
              Vous êtes bien bien largué vous !

            • eau-pression eau-pression 1er février 22:20


              Votre remarque finale est à méditer.

              D’abord, chaque fois que je me demande pourquoi je n’interviens pas sous mon nom, c’est cet argument le plus décisif pour rester sous pseudo : ne pas porter tort aux gens qu’on apprécie.

              Ensuite, le jour où il y aurait un flicage plus serré, vu qu’au même titre que tous les intervenants ici vous êtes déjà identifiable par les autorités, vous ne pourriez même plus transmettre ce témoignage. A ce jour, il y a des observateurs sur les forums, mais on peut douter qu’ils aient pour mission de pister individuellement les gens.

              Reste la question de principe : quand les témoins directs auront disparu, que les descendants iront chercher des informations à l’état-civil, c’est une information fausse qu’ils recevront.

              A l’heure d’internet, on a les moyens techniques de ne pas laisser les gens au pouvoir écrire l’histoire.

              Il y a des gens convaincus que cet état d’urgence, son conseil de guerre sanitaire secret, c’est pour notre bien.

            • Philippe Huysmans, Complotologue Philippe Huysmans 1er février 22:26


              T’es assez intelligent pour savoir que ton pseudonymat ici ne vaut que pour les lecteurs qui ne connaissent pas ta vraie identité (comme moi).

              Pour les flics, c’est transparent, je t’assure.

            • Aita Pea Pea Aita Pea Pea 1er février 22:35

              @Philippe Huysmans . On sent ici le vrai refificateur ou un truc comme ça dans cette menace qui n’en est pas une mais qui ...

            • Philippe Huysmans, Complotologue Philippe Huysmans 1er février 22:46

              @Aita Pea Pea

              Mais oui bien sûr je représente une menace absolument terrifiante pour un ami avec qui j’entretiens une correspondance régulière par e-mail.

              C’est évident ! Je vais le dénoncer à la Kommandantur (ou à l’Insee, comme nonosse).

              Je vois que depuis deux heures t’es désespéré parce que tu t’adresse à moi... et je ne te réponds pas. 

              Mais va falloir t’habituer, j’en ai un peu soupé de ta mesquinerie, de ta veulerie, de tes tortillages de cul quand tu sais parfaitement que tes « potes » se comportent comme des crapules sans aucune moralité.

              Alors je vais t’ignorer. Je pourrais facilement te mettre en pls quand par exemple tu viens traiter Cyrus de crétin des Alpes, et j’ai du me tenir à quatre pour ne pas le faire, mais je crois que pour toi, le mieux, ce sera le silence, et le mépris.

            • Aita Pea Pea Aita Pea Pea 1er février 22:51

              @Philippe Huysmans . Ok . Pour Cyrus j’enlève « des alpages  » . Mais c’était déjà dit subrepticement il me semble .

            • Aita Pea Pea Aita Pea Pea 1er février 22:57

              @Philippe Huysmans . Toute manière pour le mépris , je suis a peu près sur que ta femme te fais des frites à la végétaline .

            • Garibaldi2 2 février 03:09


              ’’Elle se déplace mais le temps d’arriver la personne est décédée et le samu, prévenu manifestement avant la toubib, a déjà, contre toute autorisation légale, rédigé le certificat de décès avec mention, devinez quoi, « COVID 19 » !!!’’.

              C’est le médecin qui en premier constate le décès qui doit rédiger le certificat de décès :

              L’article L2223-421 du code général des collectivités territoriales dispose que « L’autorisation de fermeture du cercueil ne peut être délivrée qu’au vu d’un certificat, établi par un médecin, attestant le décès. »

              Trois situations se présentent en fonction du lieu du décès :

              • si le décès survient à l’hôpital ou dans une clinique privée (75 % des cas), le médecin de l’établissement se charge du constat ;
              • si le décès survient à domicile ou dans un établissement non médicalisé, c’est le médecin qui arrive sur les lieux et constate le décès (médecin traitant ou médecin de garde) qui délivre le certificat de décès (imprimé bleu en trois volets) ;
              • si le décès survient sur la voie publique ou si l’intervention des services de police ou de gendarmerie a été nécessaire, le certificat de décès peut être établi par un médecin désigné par le procureur de la République du département concerné.

              Il faut savoir que le certificat de décès doit être signé rapidement ; sans cette pièce, le transfert du défunt par les pompes funèbres est interdit.

              Le constat de décès doit être réalisé sur les lieux du décès par tout médecin inscrit à l’Ordre des médecins. Le médecin doit être appelé dès que le décès est supposé par la famille, les témoins ou les secouristes.


            • @Garibaldi2

              ca fait beaucoup de copier coler tout ca , tu les redige tout seul ou on te les fournis ? 

            • Garibaldi2 2 février 04:08

              @ㄈϤ尺Цら(« ochlocrate »)

              Comme vous n’avez rien à dire sur le fond, il faut bien que vous tentiez une pirouette !

              Au fait, pour votre info, j’ai voté contre Maastricht et contre le TCE et je l’ai écrit à plusieurs reprises sur Avox.

            • @Garibaldi2

              c’ est vrai qu’ en le repetant mille fois ca devient tout de suite plus vrai 
              si tu le repette encore une fois , tu en aura au moins convaincus un ...toi meme smiley

              Allez je suis pas vache je te laisse copier coller en paix ...ou pas ...

            • Garibaldi2 2 février 04:32

              @ㄈϤ尺Цら(« ochlocrate »)

              Clap de fin pour vous !

            • eau-du-robinet eau-du-robinet 2 février 05:51

              Bonjour gnozd,
              Merci pour votre témoignage éloquent. smiley
              Il y des donneurs d’ordre tout en haut de la pyramide qui ont réussi de nous vendre une épidémie pour une pandémie et ceci été possible due au « test » PCR bidon du « Dr » DROSTEN !
              Le lobby pharmaceutique est un de plus puissant du monde.
              Bill Gates « sponsorise » les journaux comme le Monde pour faire la promotion pour des vaccins ... voire aussi cet article
              Ce n’est plus un secret, un grand nombre de personnes sont corrompu par le fric des milliardaires, même l’OMS et cela ne date pas d’hier.
              L’industrie pharmaceutique à une puissance financière telle qu’elle peut à elle tout seule dicter la politique sanitaire des gouvernements pour nous vendre des produits hors de prix en éliminant les remèdes ayant fait leur preuves et qui coutent pas cher ! Tout cela au dépend des finances de la sécurité sociale et nos mutuelles.
              Qui dicte la politique sanitaire des gouvernements ?
              Ce sont les gens ayant « des conflits d’intérêts » qui touchent des « cadeaux »... bref un bon nombre de médecins qui se laissent corrompre.
              Lobbying : comment l’industrie pharmaceutique prend d’« assaut » les institutions européennes
              Nos hommes politiques ne servent pas l’intérêt général mais celui du monde de la très grande financé, prêt à sacrifier la classe moyenne, ainsi la classe populaire, et je vous ne parle même de leur indifférence totale envers les SFD’s !!!
              Les élection sont totalement biaisé par le pouvoir médiatique qui est dans la main des milliardaires !
              Que nous votons droite ou gauche, tous pourri par le pouvoir du fric !
              Ses gens se prennent pour l’élite et nous pour leurs esclaves.
              carotte et le bâton (135 €)
              participation a une manifestation non déclaré = 135€
              pas d’attestation de déplacement dérogatoire = 135 €
              non respect du couvre feux = 135 €
              rassemblements non autorisées = 135€

              Une amende de 135 € pour avoir fleuri la tombe de son père en plein confinement ?
              La police à été en quelques années transformé en milice !
              Les policiers se sont laisse acheter pour 150€ de plus par mois !


              En Allemagne les pharmaciens et d’autres gens du secteur médicaux ont reçu une lettre des autorités de ne pas informer les gens sur les vaccins !!!!
              Vidéo en allemand (passage à partir de 1:25:32) témoignage d’une psychothérapeute.

              « Wir werden ganz eindeutlich aufgefordert nicht aufzuklären .... Wir sollen über die Impfung nicht aufklären ! »

              « On nous demande clairement de ne pas informer les gens ... On ne doit pas informer les gens sur la vaccination »
              C’est une réunion entre des gens qui ont crée un nouveau partie politique en présence de l’Avocat Reiner Füllmich

            • eau-pression eau-pression 2 février 08:40

              Bonjour @gnozd

              Vous avez déclenché sans le vouloir pas mal de réactions. En voici encore une, que vous la lisiez ou non.

              D’abord bonjour aussi aux deux mousquetaires qui n’ont qu’un défaut : ne pas être gascons. Mais doit y avoir moyen de les introniser, quelque part du côté d’Eauze.

              Commençons par les généralités, il paraît qu’on ne sait jamais où je veux en venir. Donc, à lire votre réflexion, je me suis demandé : je ne veux pas qu’il y ait des points sur ma carte d’identité, mais pourquoi ?

              Il y a une réponse assez facile. Il y a un état français pyramidal par définition, et en haut de cette pyramide il y a un monsieur pour qui le mot nation c’est juste 6 lettres. Ce monsieur, selon toute apparence, pense que le fait que j’aie une CI française lui donne tout pouvoir sur moi (et les dizaines de millions d’autres comme moi).

              Encore une scène de ménage stérile à l’horizon avec la loi et ses représentants (ceux qui ont toujours raison) ? Croyez-moi, mes conflits avec la loi n’ont jamais porté tort à personne.

              Mais il semblerait qu’aujourd’hui, être normal ce soit d’accepter les règles sans les comprendre. Autrement dit, il ne faudrait pas chercher la différence entre normal et standard. Mon sentiment, c’est que les gens standards sont des gens qui refusent l’effort pour aller du particulier au général. Et, parenthèse, je sais que c’est ça qui les irrite dans mes posts, ce besoin de comprendre qu’ils assimilent à de la prétention.

              Alors, deux exemples de standards contestables.
              on vous dit qu’aujourd’hui, pour avoir de l’eau chaude au robinet il faut un ballon d’eau chaude. Dans notre département ensoleillé des P.O., certains plombiers trouveraient fou de se poser la question d’une alternative. On peut trouver fou qu’ils ne se la posent pas.
              enfant et adolescent, vous vivez dans la certitude que deux droites parallèles ne se rejoignent jamais. Vérité écrite sur votre cahier d’écolier, d’où effectivement on imagine mal les segments de droites parallèles s’évader pour confluer plus loin. Vous devenez grand et patatrac, on vous plonge les droites dans un espace projectif, elles ont un point commun, et tout devient plus simple. Et vous acceptez qu’on vous ait caché ça quand vous aviez encore l’esprit vif ? Desargues s’est décarcassé pour rien ?

              Il y a une autre version du principe d’aller du particulier au général, c’est d’aller du local vers le global. Le témoignage que vous nous portez, si on l’intègre dans le paysage national, un phénomène grave menace : « on » se croit permis d’écrire notre histoire. Cette prétention de nos pseudo-responsables justifie et confirme les réticences qu’on éprouve face au modèle citoyen chinois. Nos droits ne sont pas modulables d’en haut. Avec mes voisins, je règle les questions de cohabitation, de partage de l’eau, etc. Le devoir que j’ai, c’est d’établir la confiance avec eux, sans quoi l’existence devient invivable.

              Je ne vous en voudrai pas de ne pas me lire lus loin. Juste un compte à régler avec un qui m’envoie des « cons » haineux. Ce con là conteste les impressions que m’a laissé à l’époque le traitement médiatique de l’accident de Millas. Impressions que j’avais consignées dans mon seul article sur Avox. Des impressions pas simulées, parce j’étais passé là deux heures avant, que je voyage souvent en même temps que les élèves dans les bus et que j’ai été immergé quelques années dans les questions d’automatismes. Mon sentiment de l’époque est qu’on allait priver les parents de vivre ce traumatisme, de faire leur deuil.
              Or, voici quelques faits. Les journalistes ont écrit, dit et redit, que deux personnes de la SAUR ont vu le bus faire sauter la barrière. Il est écrit aussi qu’ils ont consigné ce témoignage. On donne le nom d’un des deux, habitant de Trouillas. C’est dans les journeaux, je ne les ai pas rencontrés, ces gars là. Par contre, j’ai eu pour compagnon de voyage, deux ans plus tard, un gendarme dont les vosins de bureau étaient responsables de l’enquête sur la trace de l’impact de la barrière sur le bus, et il m’a dit avec réticence qu’à son avis la preuve n’était pas encore établie, et qu’en tout état de cause cette affaire était délcate et qu’il ne souhaitait pas continuer sur le sujet. Je ne pense pas nuire à cette personne en vous rapportant cette bribe d’information. Le comportement standard, c’est de ne pas se poser de questions. D’accepter une hypothèse qui saute aux yeux : la conductrice est dans le déni. Et si on avait convaincu les témoins de dire ce qui va bien pour l’intérêt général ? osef

            • gnozd gnozd 2 février 10:00

              @Philippe Huysmans

              Ca c’est sûr, mais on peut encore espérer que pour l’instant, ils ont d’autres chats à fouetter...

            • Ouallonsnous ? 2 février 19:48


              Désolé, mais la voix du policier témoignant est tellement « brouillée » que l’on ne comprend rien !

            • eau-du-robinet eau-du-robinet 4 février 02:12

              Bonjour gnozd,
              Merci pour votre message smiley
              "Elle se déplace mais le temps d’arriver la personne est décédée et le samu, prévenu manifestement avant la toubib, a déjà, contre toute autorisation légale, rédigé le certificat de décès avec mention, devinez quoi, « COVID 19 » !!!

              Elle leur demande pourquoi ils ont marqué ça, ce à quoi ils lui répondent « on nous demande de marquer ça ». ON nous demande...C’est pas incroyable ? ON nous demande..."

              En plus ça paye !!!
              Déconfinement : les généralistes payés 55 euros par patient testé positif avec recherche de cas contacts


            • cyrus MandalorianSithReaper 4 février 02:18


              Oui il faut le dire ...
              nous tous , si nous pretons l’ oreille a nos generaliste , on aprend des chose effarante , meme eux se pose des question sur la strategie sanitaire ...

              Ici c’ est des dizaine de vaccin gaché , car les rendez vous ne vienne pas , mais compté comme gens vacciné (sic)

              absolument incroyable vu le nombre de volontaire que l’ on refuse a la vaccination car hors criterre ...

              le vaccin cible certaine population pas d’ autre ...moi ca me laisse sur le Q 

            • rogal 1er février 14:15

              Très bon article, à un ’’Galilée’’ près...
              Dénonciation à faire passer dans le grand public, par tous les moyens.

              • eau-du-robinet eau-du-robinet 1er février 14:36

                Bonjour rogal,
                Merci pour votre commentaire smiley

                OUI, il faut partager ses informations à un public le plus large possible.
                Aidez nous à détruire ce château de cartes de mensonges produisant journellement des chiffres astronomique et mensongères dans leur interprétation liée au dit « test » PCR de Drosten qui n’est pas un test mais une escroquerie monstrueuse !

              • Pascal L 1er février 18:52

                Le pauvre Galilée, on le met à toutes les sauces. Ben non, il n’a pas annoncé que la Terre était ronde, ça, on le sait depuis le quatrième siècle avant notre ère et son diamètre a été mesuré avec une bonne précision deux siècles plus tard par Eratosthène. Galilée annonçait que la Terre tournait autour du soleil, mais ce n’est toujours pas ce qui lui a été reproché, car cela aussi avait été annoncé avant lui. Ce qui lui était reproché, c’est de n’avoir pas été capable de le prouver à partir du mouvement des marées comme il l’avait promis et aussi d’avoir commis un faux. Malgré cela, il a continué a être payé par le pape... Un péché pas si mortel.

              • popov 1er février 14:37


                Merci pour cet excellent article.

                • Emohtaryp Emohtaryp 1er février 14:45


                  Excellente enquète !

                  Un complément sur l’appel d’offre concernant ces fumeux tests en mai juin 2020, et déjà le scandale :


                  Ce qui fait évidemment suspecter bien au delà de l’incompétence, une volonté manifeste de manipuler....

                  • eau-du-robinet eau-du-robinet 1er février 14:58

                    Bonjour Emohtaryp,
                    Merci pour votre commentaire. smiley

                  • eau-du-robinet eau-du-robinet 1er février 15:05

                    Si Kary Mullis était encore vivant je pense qu’il sera remonté au plafond vue l’usage faite de sa méthode PCR par le « Dr » Drosten !
                    Il aurait certainement dénonce cette escroquerie tout de suite !
                    Je n’ai pas encore recherche la cause de sa mort : Mais je trouve quand même bizarre qu’il meurt soudainement, seulement quelques mois avant l’apparition du Virus Covid-19 ?


                    • tonimarus45 1er février 15:27

                      bpnjpur-En copie/colle«  »«  »«  »«  »

                      Malgré l’interdiction en vigueur adoptée face à l’épidémie de Covid-19, certains restaurants continuent de servir clandestinement les clients. C’est le cas de L’Annexe situé dans le IVe arrondissement de Paris. Une dizaine de personnes ont été verbalisées le 29 janvier, en majorité des magistrats qui travaillent à la cour d’appel.

                      La police a verbalisé vendredi 29 janvier des magistrats installés dans un restaurant clandestin sur l’île de la Cité dans le IVe arrondissement de Paris, rapporte Le Parisien.

                      Il s’agit de l’établissement L’Annexe, situé en face de la cour d’appel de Paris et à une centaine de mètres de la préfecture de police, qui accueillait à l’heure du déjeuner sur sa terrasse fermée une dizaine de personnes, qui plus est sans masque.

                      Comme le relate le quotidien, lorsque la police a procédé à un contrôle d’identité, la plupart des clients, des magistrats, ont essayé de déstabiliser les agents en leur demandant les motifs de leur intervention, sans succès. Ils ont tous écopé d’une amende de 135 euros.(PARAIT IL,PARMI EUX LE PREFET LALLEMENT ??????????)

                      • tonimarus45 1er février 15:31

                        @tonimarus45—suite du copie/colle qui cte ce fameux prefet--- Il y a 150 policiers qui passent tous les jours devant, le préfet Lallement qui passe par la porte juste à côté, le gérant aurait aimé qu’on vienne lui dire que ce qu’il faisait n’était pas dans les clous », défend auprès du quotidien un proche du restaurant. ??????????

                      • Dr Destouches Dr Destouches 1er février 16:28
                        SELON LE CEPIDC(Centre d’épidémiologie sur les causes médicales des décès)LE NOMBRE DE DECES EN 2020 ,DU AU COVID EST DE 25 000 ET NON DE 60 000


                        David Mendels,physicien

                        Le Ministère de la santé a homologué une liste de 23 tests COVID ,le 20 mai 2020, dont la plupart, selon les propres termes, du physicien sont « tout pourris ». Entendez par là qu’ils peuvent diagnostiquer des personnes saines comme étant malades du Covid. Et plus grave, des personnes malades, saines. Sur les 11 tests sur lesquels a travaillé David Mendels, un seul a franchi la barre de la fiabilité selon les critères établis par la haute autorité de santé (HAS) en matière de spécificité et de sensibilité. Pourtant dans la liste finale, la plupart y compris les pires, ont été homologués par le Ministère.

                        • eau-du-robinet eau-du-robinet 1er février 16:59

                          Bonjour Dr Destouches,
                          Merci pour votre message. smiley

                        • Ecométa Ecométa 1er février 20:03

                          Cette fois au plan mondial, les test PCR- T de DROSTEN seront à la médecine ce que les avions renifleurs, véritable escroquerie, ont été à l’aéronautique française entre 1975 et 1979 et révélée par le « Canard enchainé » en décembre 1983.

                          Une belle escroquerie au détriment de Elf Aquitaine entreprise publique de l’époque dans laquelle ont trempé V.G.E.,Raymond Barre, et qui prévoyait la construction d’un avion capable de détecter à coup sûr les gisements de pétrole !

                          • ETTORE ETTORE 1er février 20:27

                            C’est à se demander qui est le plus dangereux de ces humains mutants dégradés par le pouvoir, ou ce virus procréé.... si malicieusement.

                            Soit la dangerosité du virus n’est qu’un pipo...

                            Soit la dangerosité du virus n’est qu’un pipo....mais sert de couverture à des ingénieries, politiques, culturelles, sociales, financières.....

                            Soit la dangerosité du virus n’est pas un pipo, mais alors, comment comptent ils, eux, passer au travers ?

                            Soit la dangerosité du virus n’est pas un pipo, mais les partenaires d’un jour, devenus ennemis, pour toujours, se sont scindés en plusieurs camps, histoires de saloperies peu avouables, de compromis en trahisons, et nous, terrorisés, comptons les points....

                            Soit...Tout ce beau monde s’est fait manipuler par un « ordre », bien supérieur, qui les as tous baladés comme des neuneus, à coup de milliards gratos dans leurs pognes avides, et dont ils se retrouvent aujourd’hui....Qu’avec les conséquences désastreuses de leur traitrise à gérer, dernière tentative de résistance par la com, pourraves, et des mesures toutes aussi débiles les unes que les autres, avant de se faire juger par des tribunaux, comme traitres à leurs nations. Au mieux comme assassins !

                            Ce à quoi pourrait aussi bien servir, ce coup du « manquement des vaccins », et que ces lascars hors sol, du drapeau bleu étoilé, commencent à comprendre, de plus en plus clairement, qu’ils ont vendu leur âme au diable, et que maintenant, il va falloir.....

                            PAYER LA NOTE  !

                            • eau-du-robinet eau-du-robinet 1er février 21:09

                              Bonjour ETTORE,
                              Merci pour votre commentaire.
                              Vous êtes sur le bon chemin car vous vous posez des bonnes questions.
                              Comment font le décodeurs de l’information pour différencier entre le vrai et le faux ?
                              Première question qu’il faut se poser : A qui profite le crime ?
                              2ème étape. Regardez les informations des grandes chaines, environ 15 minutes par jour (ça suffit), ils font passer tous les mêmes informations, prise à l’AFP, répète du matin au soir. (Pensez unique pensée mondialiste) Puis, prenez beaucoup de temps pour vous informer sur des médias libres ! Discutez avec des gens informé et échangez des informations.... c’est ce qu’on fait entre autre ici ... mais je le fait aussi beaucoup par émail ....
                              Puis comparez les informations des médias libres et celles des médias dominantes.... faite confiance à votre intuition pour tirer les bonnes conclusion.
                              "C’est à se demander qui est le plus dangereux de ces humains mutants dégradés par le pouvoir, ou ce virus procréé.... si malicieusement."
                              La réponse est clair et net :
                              Le plus dangereux sont ces humains mutants dégradés par le pouvoir et pas le COVID-19.
                              Comment reconnaître un mouton ?
                              Facile, c’est celui qui à peur du Covid-19 car il n’est pas informé de ce qui passe en arrière coulisse, notamment à DAVOS...
                              Pour être informé il faut consacrer du temps, lire et regarder des vidéos, ... c’est le prix à payer que peu de gens sont prêt à investir ....

                            • eau-du-robinet eau-du-robinet 1er février 22:13

                              Ré-Bonjour ETTORE,

                              Je vous conseille si ce n’est pas déjà fait de regarder au moins les 10 premières minutes de cette vidéo des médecins qui n’ont pas de liens avec l’industrie pharmaceutique :

                              Que constatez vous quand vous regardez ses médecins ?

                              Aucun porte un masque, ni distanciation de 2m ?
                              Sont ils fous ? Non pas du tout ! Ils sont bien informé !

                              Je vous le dit le port des masques c’est du pipo tout comme la distanciation sociale !
                              La transmission se fait essentiellement par les mains.... qui passent ensuite sur le yeux voire ne nez..... et bonjour quand vous tripotez le masque surtout quand il devient humide. Lisez cet article ...

                              Le virus Covid-19 ne peut pas traverser la peau.
                              Donc bien se laver les mains avec du savon et au moins 20s savonner...
                              En les écoutent, les médecins, je déduit que le gouvernement Macron à tout fait depuis le début pour ne pas protéger la population française, en prétendant avec la complicité des média qu’il n’y avait pas de traitement, qu’il n’y avait pas de solution pour combattre le Covid-19, et créent ainsi une psychose du méchant virus chez des gens et en préparent les gens pour la solution miracle, le vaccin ARN qui est promu comme la solution miracle ! ATTENTION DANGER !!!
                              Cela devrait faire sonner la sonnette d’alarme chez des gens, se faire vacciner par un vaccin expérimental .... HALLO ?
                              Il faut 5 à 6 ans pour développer un vaccin !!!

                              La prévention passe d’abord par le renforcement de système immunitaire, c’est à dire par un apport journalier suffisant, soit par l’alimentation soit par des compléments alimentaires, en :
                              vitamine D (D3),
                              du ZINC (oligoélément),
                              vitamine C,
                              voir BI-ORTHOX,
                              voir AZINC
                              voir EGRY D Plus, ...

                              Un système immunitaire affaiblie est un terrain propice pour être mal mené par de virus ...

                            • Ecométa Ecométa 1er février 21:03

                              Nous sommes gouvernés par des GOGOS !

                              On le montre dans les télé mainstream ! Avec le couvre-feux à 18h00, c’est le retour des « pandores » dans les rues, sur les routes et autoroutes. C’est le retour de ces gendarmes et policiers obéissants et passifs ! On se croirait revenu un demi siècle en arrière, aux temps des « argousins »,des « cognes », des « bourres » : de forces de l’ordre sans cervelle !

                              • Old Dan Old Dan 1er février 22:41

                                SEN-SA-TION-NEL !

                                Vous nous sauvez la vie...


                                [... et dire qu’on aurait pu passer à côté d’une telle information ! ]

                                • Bertrand Loubard 1er février 22:55

                                  Merci pour cet article. Comme pour le PNAC et le 9/11, comme pour la préparation de la crise H1N1 (échec GSK) et celle de la Covid19 (Event 201), la prochaine étape est connue et déjà décidée au niveau de l’« Etat profond–Complexe militaro-industriel - Banque-Assurance » : une super attaque cyber terroriste géante paralysant le monde entier de la production et de la distribution de l’énergie .... Une semaine suffira pour laisser le « Pouvoir » régner sur le restant de l’humanité .... dont la taille sera redevenue gérable ..... Qui sera le premier à invoquer la légitime défense préventive ?
                                  Bien à vous

                                  • yvesduc 2 février 07:19

                                    Je crains qu’il n’y ait un énorme malentendu dans votre chiffre de 3 %. Tel que vous le présentez, cela signifierait qu’une énorme majorité de gens (97 %) sont porteurs d’une quantité infinitésimale de virus (viable ou non, peu importe puisque le PCR ne fait pas la différence). On se demande bien pourquoi puisque les contaminés deviennent assez vite négatifs au tests PCR, en quelques semaines. Il existe des patients qui restent positifs plusieurs mois mais ils sont rares. Je me demande si les 3 % ne désignent pas plutôt les échantillons qui DEVIENNENT positifs à partir de 35 cycles !

                                    Si votre chiffre est exact, pourquoi un positif sur deux a-t-il des symptômes en France ? (SPF ici, ici, ici et ici par ex.) Cette proportion est à peu près identique à celle que l’on trouve ailleurs.

                                    Si votre chiffre est exact, pourquoi ai-je une douzaine de malades dans mon entourage ? Le taux d’incidence hebdomadaire est actuellement de 211 / 100k habitants (covidtracker ; je n’ai pas trouvé de moyenne historique), soit 0,211 % de chance de tomber sur une personne contaminée. Si l’on en garde seulement 3 %, cela donne 0,00633 %. Environ la moitié n’ont pas de symptômes, soit 0,0032 %. Multiplié par 44 semaines (onze mois), cela donne 0,139 % de chance de croiser un malade au cours des onze derniers mois, soit un peu plus d’une chance sur mille. Et pourtant, j’ai 6 formes légères, 6 formes sévères et 2 décès dans mon entourage (famille, collègues, amis, voisins, etc.). J’ai eu (selon votre chiffre) 14 fois une chance sur mille ! Je devrais jouer au Loto ! smiley 

                                    • Garibaldi2 2 février 11:15


                                      N’essayez pas de présenter des arguments raisonnables à des personnes qui ne le sont pas ! Eux et la logique ...... !

                                    • eau-du-robinet eau-du-robinet 2 février 14:29

                                      Il suffit d’voir un rhume il y quelques mois et les PCR de Drosten affiche positif !
                                      Le test de Drosten affiche même des fragments des virus morts comme positif !

                                      Avez vous lu mon article en entier ?
                                      Voici une citation :
                                      ( 32:15 ) En Septembre 2020 le CDC (Center for Desease Control) l’équivalent du RKI en Allemagne ... avait déjà mentionné dans le passé que si un test PCR est positif cela ne signifie pas forcément la présence d’un virus infectieux. A l’époque le CDC avait déjà dit qu’un test purement positif ne peut pas dire s’il existe une infection !!!
                                      Toujours selon le CDC avec le test (PCR) on ne peut pas exclure, malgré un test positif, s’il s’agit d’un autre agent pathogène qui a provoqué les symptômes. Ceci a été confirmé par Dolores Cahill qui avait étudié, par séquençage, 1500 tests PCR positif « Covid-19 » aux Etats-Unis pour savoir de quoi il s’agit et aucun virus Covid-19 parmi ses tests n’a été détecté. Tous les tests étaient soit influença A soit influença B !!!

                                      fin de citation

                                      ici c’est même 100% des faux !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

                                    • Ben Schott 3 février 06:20

                                      « N’essayez pas de présenter des arguments raisonnables à des personnes qui ne le sont pas ! Eux et la logique ...... ! »
                                      Parce que vouloir assigner à résidence jusqu’à nouvel ordre 7 milliards d’être humain, aux conséquences exhorbitantes, pour une épidémie de grippe dont la mortalité est d’environ 0,05%, c’est être raisonnable et logique ?

                                      Un peu d’humilité te ferait le plus grand bien.


                                    • yvesduc 3 février 07:01


                                      Un rhume supprime-t-il le goût et/ou l’odorat ?

                                      Le test PCR porte sur des gènes spécifiques du SARS-Cov2. Le rhume n’est pas détecté (RTS).

                                      La détection des virus morts, oui c’est connu mais la mise en culture peut difficilement être mise en œuvre à grande échelle.

                                      Les limites de la science sont connues : avez-vous mieux à proposer ?

                                    • eau-du-robinet eau-du-robinet 3 février 08:42

                                      « Un rhume supprime-t-il le goût et/ou l’odorat ? »
                                      réponse : NON ! 
                                      Croyez vous que toutes les personnes testé positif ont eu soit une perte d’odorat voir une perte du goût ?
                                      Certainement pas.
                                      « Le rhume n’est pas détecté (RTS). » C’est FAUX, c’est un véritable mensonge !
                                      Voici ce que dit l’avocat allemand, Dr. Reiner Fuellmich qui est entouré des centaines d’experts de la médecine voire de la science dans la vidéo suivante qui figure dans mon article et que vous n’avait certainement pas regarde !

                                      Vidéo à regarder à partir de 8:58

                                      et à il dit à 9:32 :
                                      « Vous ne pouvez pas dire quoi que ce soit sur les infections en utilisent ses tests PCR parce-que ce qu’ils font c’est qu’ils testent positif à presque tout, y compris par exemple des débris, les fragments d’un rhume, d’une lute de votre système immunitaire contre le rhume ! »
                                      je le répète pour vous yvesduc :
                                      et à il dit à 9:32 :
                                      « Vous ne pouvez pas dire quoi que ce soit sur les infections en utilisent ses tests PCR parce-que ce qu’ils font c’est qu’ils testent positif à presque tout, y compris par exemple des débris, les fragments d’un rhume, d’une lute de votre système immunitaire contre le rhume ! »

                                    • Garibaldi2 3 février 09:30

                                      @Ben Schott

                                      Un peu de neurones te ferait le plus grand bien !

                                      D’abord ce n’est pas la mortalité mais la létalité qu’il faut prendre en compte, ce qui est différent.

                                      Ensuite, cette létalité est obtenue grâce à des mesures de prévention qui ont été prises partout dans le monde à des degrés divers.

                                      Ensuite les Français ne sont pas assignés à résidence car si tu peux poster sur Avox c’est parce qu’il y a des gens qui produisent de l’électricité, en autres. Une bonne partie des Français travaille en présentiel.

                                      Ensuite il n’y a pas que les morts de la covid qui soient le résultat de la pandémie, il y a aussi tous ceux qui, même en n’ayant pas été hospitalisé, vont avoir des séquelles :

                                      ’’D’après une étude menée par des chercheurs chinois sur plus de 1 700 malades ayant été hospitalisés pour Covid-19, 76% des patients souffrent encore d’au moins un trouble plus de six mois après l’apparition des symptômes.


                                      Parmi les problèmes de santé les plus fréquents, 63% des ex-patients se plaignaient de fatigue ou de faiblesse musculaire, 26% de troubles du sommeil, 27% disaient éprouver encore des douleurs, et 23% souffraient d’anxiété ou de dépression.

                                      Cette liste de troubles est aussi longue que variée : 22% des ex-patients faisaient état de perte de cheveux, 11% n’avaient pas encore retrouvé totalement l’odorat, 9% avaient des palpitations, la même proportion souffrait de douleurs articulaires, 8% d’une perte d’appétit, 7% n’avaient toujours pas recouvré totalement le goût, 6% faisaient état de vertiges, 5% de vomissements ou de diarrhées et autant de douleurs thoraciques… 

                                      Dans cette cohorte, les malades les plus gravement atteints étaient aussi ceux qui, plus de six mois après les premiers symptômes, n’avaient pas encore récupéré la totalité de leurs fonctions vitales. Le fonctionnement de leurs poumons ou de leurs reins restait plus souvent altéré. Certains présentaient même du diabète, ce qui ne leur avait jusque-là pas été diagnostiqué. Enfin, leurs résultats au test de marche de six minutes étaient aussi moins bons : 29% des 116 malades ayant développé la forme la plus grave du Covid-19 et ayant passé ce test n’atteignaient pas la distance normale minimum.’’


                                    • pemile pemile 3 février 09:35

                                      @Garibaldi2 "Ensuite il n’y a pas que les morts de la covid qui soient le résultat de la pandémie, il y a aussi tous ceux qui, même en n’ayant pas été hospitalisé, vont avoir des séquelles"

                                      Cela leur a été répété des dizaines de fois depuis des mois, seule leur mauvaise foi peut expliquer leurs dénis smiley

                                      Ce qui est cocasse, c’est que c’est aussi leur prophète, Raoult, qui déclarait en mars 2020 que 60% des asymptomatiques passés à l’IHU présentaient des séquelles pulmonaires visibles au scanner.

                                    • Ben Schott 3 février 09:48

                                      « D’abord ce n’est pas la mortalité mais la létalité qu’il faut prendre en compte, ce qui est différent. »
                                      Ah bon ? Non, moi je prends la mortalité, si ça te dérange pas.
                                      « Ensuite, cette létalité est obtenue grâce à des mesures de prévention qui ont été prises partout dans le monde à des degrés divers. »
                                      Tu racontes n’importe quoi ! La létalité mesure le nombre de morts parmi les gens qui ont développé une pathologie. Et de quelles mesures de prévention tu parles ?
                                      « Ensuite les Français ne sont pas assignés à résidence car si tu peux poster sur Avox c’est parce qu’il y a des gens qui produisent de l’électricité, en autres. Une bonne partie des Français travaille en présentiel. »
                                      Ouais, baisse la tête, t’auras l’air d’un coureur ! Et ta sœur, elle travaille en présentiel, cornichon ?
                                      Les séquelles dont tu parles ensuite, surtout pour noyer le poisson, personne ne les nie, au contraire, elles justifient qu’on soigne les gens, mais pas qu’on assigne les peuples à résidence.
                                      Toi et tes copains crétins et prétentieux, vous avez l’instinct et/ou les couilles atrophiées pour ne pas voir que ça déconne à plein tube.
                                      D’où le remontage de bretelles que vous subissez de la part des gens normaux.

                                    • Adèle Coupechoux 2 février 10:05

                                      Merci pour cet article très informatif et sourcé.

                                      Ce qui incroyable c’est l’évidence que tout ceci est absurde. Autour de moi, je n’ai pas un collègue qui ne se soit pas tester, que ce soit pour « voir », aurait été cas contacts, doit voir ses grands-parents, a le nez qui coule, jusqu’aux symptômes plus sévères. Sans compter la pression de certains collègues.

                                      Je dois bien être la seule à y avoir échappé. Je leur fais remarquer qu’il est évident que ces tests sont inutiles voir délétères : Si je suis leur logique, il faudrait faire ces tests non-stop, à chaque personne croisée, ensuite se faire curer le nez n’est pas anodin et encore moins si cela devient une pratique régulière.

                                      Malgré tout ils continuent. Je leur fais remarquer que plus il y aura de tests plus les probabilités d’être positif est grand. Quant à la contagiosité, qu’en sait-on ? Avons-nous jamais testé aussi massivement la population quand nous avions la grippe, un simple nez qui coule, un rhume, une simple toux... ?

                                      Je n’ai jamais de réponse à mes questions, seulement une attitude embarrassée ou alors un " oui mais bon, je ne veux pas envoyer quelqu’un en réa ".

                                      Faut-il désormais craindre avant tout, une population qui devient de plus en plus hypocondriaque ?

                                      • Samson Samson 2 février 15:43

                                        @Adèle Coupechoux
                                        « Ce qui incroyable c’est l’évidence que tout ceci est absurde. »

                                        Absurde et insensé, mais ô combien rentable pour certains !

                                        Le discours propagandiste et anxiogène qui nous est constamment martelé par les « experts » médiatiques et les mesures auquel il ouvre sont à ce point en dissonances avec celui d’autres spécialistes parfois mondialement rénommés avant de s’être vus pour cause de « pandémie » réduits au statut de « charlatans » qu’ils m’évoquent une combinaison particulièrement hallucinée, délirante et démente de Docteur Knock et Docteur Mabuse !

                                        Par ces sombres temps, je crois ce qui est le plus à craindre, c’est l’abandon de notre libre-arbitre pour notre soumission sans condition aux plus incohérentes consignes du pouvoir.

                                        Bon courage à vous, en vous présentant mes cordiales salutations ! smiley

                                      • Adèle Coupechoux 3 février 11:47


                                        Merci pour votre message. Knock...complètement d’actualité.

                                        Oui nous avons des « experts » qui ne sont plus sur le terrain depuis bien longtemps. Macron sait s’entourer... smiley

                                        Bon courage à nous tous, il va nous en falloir et garder nos nerfs.

                                        Bonne journée

                                      • eau-du-robinet eau-du-robinet 2 février 11:58

                                        Merci pour votre message,

                                        "Si je suis leur logique, il faudrait faire ces tests non-stop, à chaque personne croisée, ensuite se faire curer le nez n’est pas anodin et encore moins si cela devient une pratique régulière."


                                        Chaque test est comptabilisé et permet au gouvernement de justifier l’injustifiable c’est à dire toutes ses mesures liberticides !

                                        Déconfinement : les généralistes payés 55 euros par patient testé positif avec recherche de cas contacts

                                        • eau-du-robinet eau-du-robinet 2 février 11:59

                                          message adressé à Adèle Coupechoux ....

                                          • GerFran 2 février 12:48

                                            Le dépistage des cas de Covid-19 sans évaluation de la charge infectieuse est un non-sens épidémiologique, alertent le vétérinaire Patrick Guérin et le médecin Didier Sicard, dans une tribune au « Monde ».


                                            Publié le 07 novembre 2020

                                            Your Coronavirus Test Is Positive. Maybe It Shouldn’t Be.

                                            The usual diagnostic tests may simply be too sensitive and too slow to contain the spread of the virus.

                                            Published Aug. 29, 2020

                                            • eau-du-robinet eau-du-robinet 2 février 13:40

                                              Bonjour GerFran,
                                              Merci pour votre message et les liens. smiley

                                            • eau-du-robinet eau-du-robinet 2 février 13:47

                                              Il y a de plus en plus de médecins voire scientifiques qui dénoncent cette escroquerie monstrueuse, enfin ...
                                              Les coupables qui ont déclenché cette hystérie doivent être traduite en justice !!!
                                              Tout à l’heure dans ma rue j’ai vue une femme seul chez elle dans sa chambre portent un masque !!! Waoooooo !
                                              Le gouvernement doit retirer toutes ses lois liberticides !!!

                                            • Samson Samson 2 février 15:08

                                              Merci beaucoup pour votre article et les liens.

                                              L’agenda d’urgence sanitaire apparaît toujours plus clairement comme le prétexte à précipiter la mise en place de ce Nouvel Ordre auquel aspire l’aristocratie mondialiste et ses puissants financiers.

                                              Et la combinaison de la mobilisation intensive d’un rouleau compresseur médiatique recourant à toutes les ficelles psychologiques (terreur, chantage, délation, ...) de la propagande avec la censure de toute opinion particulièrement scientifique ou médicale, mais tout aussi bien politique — dissidente en dit long sur l’avenir « bâillonné » qu’il nous promet.

                                              La perspective du seul « salut » transhumaniste qui nous est laissé via l’expérimentation appliquée à très large échelle sur les populations de notre planète d’une thérapie génique à visée immunogène fait frémir et devrait très sérieusement nous inquiéter.

                                              Tant au niveau hexagonal qu’international, Je reste personnellement très impressionné par la posture proprement panurgique adoptée par certaines des composantes particulièrement , si tant est que ces termes aient encore quelque sens dans l’actuelle mascarade démocratique, de « gauche » ou encore « écologistes » de l’échiquier politique et médiatique, s’inclinant sans aucune velléité de réflexion critique, et à fortiori sans combat, devant les diktats « sanitaires » décrétés par la doxa de la Pensée Unique.

                                              Quitte à me voir qualifié de « complotiste », je ne me sens plus vraiment représenté ! Mais bon, rien que de bien normal quand « La Dictature, c’est la Liberté ! » ! Et puis, je n’oublie pas qu’il paraît que c’est pour notre « bien ».

                                              En vous présentant mes respectueuses salutations ! smiley

                                              • eau-du-robinet eau-du-robinet 2 février 16:40

                                                Bonjour Samson,
                                                Merci pour votre commentaire.
                                                La reprogrammation voire l’inversement du sens des mots, comme le mot « complotiste »,

                                                fait partie de leur stratégie quand on met le doigts sur leurs affaires puantes.

                                                Idem pour l’inversement victime / accusé


                                                Je suis d’accord ... Ses gens ne sont pas nos représentants ! Je n’ai pas voté pour eu comme la très grande majorité des français, abstentionnistes inclus !

                                                Bonne journée à vous smiley

                                              • eau-du-robinet eau-du-robinet 2 février 17:04
                                                Confinement : Macron fait durer le “plaisir” - JT du lundi 1er février 2021


                                                Mr Castex, arrêtez le confinement liberticide et la guerre contre les français, surtout arrêtez de nous prendre pour des cons et de nous infantiliser !

                                                • eau-du-robinet eau-du-robinet 2 février 17:10

                                                  Et c’est quand qu’on confine le gouvernement Macron ?

                                                  Faut-il attendre 2022.

                                                          • eau-du-robinet eau-du-robinet 4 février 10:39

                                                            Phase 2, un verrouillage de l’ADN ? Sauve qui peut !

                                                            Si le récent verrouillage forcé de notre économie mondiale n’est que la phase 1 d’un plan de domination mondiale bien conçu, alors il faut s’attendre à un verrouillage mondial de l’ADN dans la phase 2. Cette émission explique ce que l’on entend par verrouillage de l’ADN. Sauve qui peut !

                                                              • eau-du-robinet eau-du-robinet 5 février 07:10

                                                                Regardez la vidéo suivante :

                                                                Séquençage : le retard français. Mortalité. Confinement.


                                                                Les décisions prise par le conseil scientifique ainsi par le gouvernement français ne sont pas prise sur la base de la science, bref c’est du n’importe quoi !


                                                                Les Virus il faut le surveiller, faire de la science, et pour comprendre ce que sont les virus il faut les séquencés.


                                                                La France est un de dernier pays dans le monde en ce qui concerne les séquençage, il y à que l’IHU Méditerranée Infection qui fait du séquençage en France !


                                                                Toutes ses polémiques et messages alarmistes plongent la population française dans la peur, merci les MERDIAS, les gens ne séquencent pas du tout, car si non ils auront constaté que les chiffres produites par le test PCR, sont complètement bidon !


                                                                Ce que me surprend par contre c’est que même le professeur Raoult, pour lequel j’ai beaucoup estime, n’a pas dénoncé cette supercherie du test PCR, en tout cas selon mas connaissance actuelle ....

                                                                • eresse eresse 7 février 18:50

                                                                  J’ai oublié de fournir le lien sur l’étude :
                                                                  https://academic.oup.com/cid/advance-article/doi/10.1093/cid/ciaa1491/5912603 de laquelle est extrait le graphique.

                                                                  oubli réparé

                                                                • eau-du-robinet eau-du-robinet 7 février 19:52

                                                                  Ré-Bonjour eresse,
                                                                  Excellent vos sources !
                                                                  Merci pour votre soutien pour que la vérité soit mise au très grand jour !

                                                                  • Le Panda Le Panda 7 février 10:37

                                                                    Je pense que ce n’est pas la faute d’AGV que mes articles restent au frigo. Il vaut mieux attendre, l’article pour certains ne veut dire, car à la place du cerveau ils ont tout et n’importe quoi...Il faut une personne ayant fait ses preuves autant pour lui que pour nous, et il existe. J’en parle dans mon article au frigo. Il est le seul à avoir toujours ou presque battu les gouvernements et les présidents en place d’une bonne longueur. Dans la mesure ou personne ne trouve je pose le lien de l’article le 7.02.2021 vers 12h. Il inadmissible de laisser les faits en l’état et d’avoir un un pingouin qui nous dirige, pour savoir et connaitre l’imbu de sa personnage. Oui Macron pourquoi l’appelez-vous toutes les semaines ? Vous pensez pouvoir le nier ? Tu vois la soirée du 3 s’est bien terminée et au moins sans masque nous avons bien rigolés. A te lire si possible toi ou les autres, bon dimanche.

                                                                    Le Panda 

                                                                    • illiadegun illiadegun 7 février 12:22

                                                                      « Directeur de l’institut de la Charité à Berlin il est un conseiller très influent du gouvernement allemand »....

                                                                      Ce n’est pas là où a été « désempoisonné » Navalny ??!!!

                                                                      • Emohtaryp Emohtaryp 7 février 14:03

                                                                        Le Ministère de l’Intérieur fédéral Allemand a embauché des scientifiques en leur demandant d’élaborer un scénario catastrophe pour justifier le confinement !


                                                                        On sent la fin de partie, là, les masques vont tomber....

                                                                        Extrait :

                                                                        Dans un échange de courriers électroniques, le secrétaire d’État au ministère de l’Intérieur, Markus Kerber, demande aux chercheurs contactés d’élaborer un modèle sur la base duquel des « mesures préventives et répressives » peuvent être envisagées.

                                                                        Selon la correspondance, les scientifiques ont travaillé en étroite coordination avec le ministère en seulement quatre jours pour développer le contenu d’un article qui avait été déclaré secret, qui a été distribué via divers médias au cours des jours suivants.

                                                                        Un « scénario du pire » a été calculé selon lequel plus d’un million de personnes en Allemagne pourraient mourir du coronavirus si la vie sociale devait continuer comme avant la pandémie.......................

                                                                        • eau-du-robinet eau-du-robinet 7 février 18:18

                                                                          Bonjour Emohtaryp,
                                                                          Merci pour cette information smiley
                                                                          Ses hommes politiques corrompus sont tous responsables pour crime contre l’humanité !!!!

                                                                        • eau-du-robinet eau-du-robinet 7 février 18:47

                                                                          Ré-Bonjour Emohtaryp,
                                                                          "Le Ministère de l’Intérieur fédéral Allemand a embauché des scientifiques en leur demandant d’élaborer un scénario catastrophe pour justifier le confinement !« 
                                                                          Ses dit scientifiques qui vont cautionner cette escroquerie monstrueuse vont se décréditer pour l’éternité quand les premiers jugements des tribunaux allemand seront rendu !
                                                                          Il sera intéressant de connaître les liens de ses »scientifiques" avec Big-Pharma et les commissions qu’il vont toucher pour produire voire cautionner des fausses informations !

                                                                        • eau-du-robinet eau-du-robinet 7 février 18:48

                                                                          correction :
                                                                          vont se discréditer pour l’éternité

                                                                        • BA 7 février 14:04

                                                                          Covid-19. Santé publique France estime que des « mesures plus strictes » seront vite nécessaires.

                                                                          La diffusion de variants du coronavirus plus transmissibles rend probable la nécessité de « mesures plus strictes » en France «  dans un avenir proche », en raison d’un nombre de malades hospitalisés déjà « très élevé », a estimé ce vendredi 5 février un responsable de Santé publique France.

                                                                          Pour l’heure, le gouvernement exclut un nouveau confinement. Jean Castex n’a d’ailleurs pas annoncé de nouveau tour de vis lors de sa conférence de presse, jeudi 4 février. Jusqu’à quand ? Santé publique France ne cache pas ses inquiétudes.

                                                                          Il est probable que le R effectif, le taux de reproduction qui mesure la dynamique de l’épidémie, « dans un avenir proche va passer largement au-dessus de 1 et donc que des mesures plus strictes que celles aujourd’hui en place deviendront nécessaires », a déclaré ce vendredi 5 février Daniel Lévy-Bruhl, responsable de l’unité infections respiratoires de l’agence de santé publique, lors d’un point de presse hebdomadaire.

                                                                          Cette augmentation prévisible du taux de reproduction est liée à « la poursuite de la diffusion des variants » qui ont émergé au Royaume-Uni, en Afrique du Sud et au Brésil.

                                                                          La proportion de cas suspectés d’être l’un de ces trois variants plus contagieux s’élevait, au 27 janvier, à 14 % du total des cas détectés, selon des résultats encore préliminaires publiés jeudi. Au 7-8 janvier, la proportion du variant britannique avait été mesurée à 3,3 % des cas positifs.

                                                                          «  La dynamique mise en évidence entre ces deux enquêtes malheureusement confirme la diffusion progressive de ces variants », observe M. Lévy-Bruhl.

                                                                          Les résultats définitifs, issus des séquençages des cas suspects, devraient être disponibles la semaine prochaine, selon Santé publique France.

                                                                          La semaine dernière, le taux de reproduction du Sars-Cov-2 a un peu ralenti par rapport à la semaine précédente, mais est resté légèrement supérieur à 1, seuil qui marque une accélération de l’épidémie.

                                                                          «  Tant qu’on a un R supérieur à 1, on ne peut pas durer longtemps comme cela, ne serait-ce que parce que le niveau aujourd’hui d’incidence et de charge hospitalière est déjà élevé , avec près de 28 000 malades hospitalisés, dont plus 3 200 en réanimation  », souligne Daniel Lévy-Bruhl.

                                                                          Même un taux de reproduction à 1, ce ne sera pas suffisant pour nous tirer d’affaire, juge l’épidémiologiste. En effet, cela signifierait « un nombre constant de nouvelles hospitalisations », mais en raison de la durée du séjour des patients, le nombre de nouvelles hospitalisations est supérieur au nombre de sorties et donc les hôpitaux vont se remplir.

                                                                          Avec 143 325 nouveaux cas détectés la semaine dernière, la circulation du coronavirus s’est stabilisée à un niveau très élevé, relève Santé publique France dans son bulletin hebdomadaire.

                                                                          Le taux de positivité des tests de dépistage est redescendu de 7,1 % à 6,7 %, les nouvelles hospitalisations sont restées stables à environ 11 100 et les admissions en réanimation ont augmenté de 6 % à 1 800.

                                                                          https://www.ouest-france.fr/sante/virus/coronavirus/covid-19-sante-publique-france-estime-que-des-mesures-plus-strictes-seront-vite-necessaires-7144359 ?

                                                                          • eresse eresse 7 février 17:17


                                                                            Analyse du test PCR en milieu médical par mise en culture des échantillons pour confirmation :



                                                                            Quelques conclusions de l’étude laissent a réfléchir.

                                                                            • L’importance du nombre de cycles de PCR (Ct), à la fois dans le compte rendu clinique et dans l’interprétation clinique
                                                                            • Qu’à l’exception des cas d’hospitalisation extrême (qui n’ont pas été étudiés), tous les cas positifs détectés avec la RT-PCR plus de 10 jours après l’apparition des symptômes ou l’exposition correspondaient à des virus non infectieux (fragments de virus morts) (aucun virus n’a pu être cultivé dans des cultures cellulaires optimales)
                                                                            • Qu’aucun délai n’a été observé pour la détection de ces virus non infectieux (fragments de virus morts), car ceux-ci ont été obtenus, avec une Ct=28-39, jusqu’à 60 jours après l’apparition des symptômes ou l’exposition.
                                                                            • Qu’à moins de 10 jours, avec un Ct=18-40, près de la moitié des « positifs » étaient des virus non infectieux (fragments de virus morts)
                                                                            • Un seuil opérationnel de Ct=30, au-delà duquel les « positifs » ont moins de 40% de probabilité (<8% à Ct>35) de correspondre à un virus viable, indépendamment du temps relatif à l’apparition des symptômes ou à l’exposition (leur figure 2)

                                                                            Comme vous pouvez le constater, l’amplification au delà d’un facteur 30 est inutile et ne génère que des faux positifs.

                                                                            Santé publique a malhonnêtement fabriqué une nouvelle définition de ce qui constitue un « cas ».

                                                                            actuellement, tout cas « positif » dans le « test » RT-PCR défectueux est désormais considéré comme un « cas » par santé publique et la « pressetituée ».


                                                                            Un « cas » est défini en médecine comme une infection active, symptomatique et diagnostiquée.

                                                                            Et pour finir, une analyse du rapport Drosten, avec , entre autres, identification des séquences recherchées pour décréter un positif.


                                                                            Ce rapport a été soumis au site eurosurveillance en même temps qu’une demande de suppression d’une publication considérée comme « erronée » sur ce site (Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR” (Eurosurveillance 25(8) 2020), pour les raisons explicitées dans le rapport.

                                                                            • eau-du-robinet eau-du-robinet 7 février 18:28

                                                                              Bonjour eresse,
                                                                              Merci pour votre message. smiley
                                                                              Le dernier lien cité dans votre message figure dans mon article :
                                                                              Voici l’extrait :


                                                                              Un court extrait du rapport traduit en français / voir le lien haut dessus :

                                                                              Cet article montrera de nombreuses failles graves dans l’article de Corman-Drosten, dont l’importance a conduit à un diagnostic erroné dans le monde entier des infections attribuées au SRAS-CoV-2 et associées à la maladie COVID-19. Nous sommes confrontés à des verrouillages stricts qui ont détruit la vie et les moyens de subsistance de nombreuses personnes, l’accès limité à l’éducation et ces restrictions imposées par les gouvernements du monde entier constituent une attaque directe contre les droits fondamentaux des personnes et leurs libertés personnelles, entraînant des dommages collatéraux échelle globale.

                                                                            • eresse eresse 7 février 18:59

                                                                              effectivement et désolé pour cette redite.
                                                                              A priori, l’article incriminé n’a toujours pas été retiré du site, il faut dire que le controversé docteur Drosten fait partie du comité de rédaction du site Eurosurveillance. Il ne va pas censurer un article de son fait.

                                                                            • eau-du-robinet eau-du-robinet 7 février 19:49

                                                                              Ré-Bonjour eresse,
                                                                              Encore Merci pour votre commentaire précédent.
                                                                              Vous avez bien fait d’avoir cité ce document très important ce que montre que vous avez bien compris le fond de cette escroquerie.
                                                                              Je vous remercie d’avoir re-cité cette source, sachent que mon article est très long et il faut vraiment investir du temps pour le lire entièrement et regarder les 4 vidéos voire pour vérification scruter les sources.
                                                                              Pour moi il est important de luter contre les fake news des médias mainstream français ainsi contre cette FAKE-PANDEMIE, qui n’est pas plus mortifère qu’une grippe ordinaire.
                                                                              Ce FAKE test PCR de DROSTEN est la basé de toutes les fausses chiffres avec lesquelles les médias mainstream terrorisent la population française, sèment une peur qui n’a pas lieu d’être quand on est bien informé, ce que les grands médias ne font pas.
                                                                              Ce weekend j’ai contacté plusieurs dizaines d’avocats à travers la France pour me porter partie civile en vue d’organiser un recours collectif en suivant l’exemple de Reiner Fuellmich ....
                                                                              La semaine dernière j’avais déjà contacté l’avocat du professeur Rault, Maître Di VIZIO sans réponse de sa part .... pour le moment.
                                                                              Je souhaite comme l’avocat DR Reiner Fuellmich qu’on lance plusieurs procès en commencent par celui du test PCR.
                                                                              On doit aussi lancer un procès ciblé contre ceux qui ont interdit voire fait restreindre l’utilisation de l’hydroxychloroquine !
                                                                              Puis un autre procès contre ceux qui ont exclus les médecins traitants d’intervenir activement dans la phase du début de la contamination avec le Covid-19 ce qui à conduit aux encombrement des URGENCES !!!!
                                                                              Écoutez ce message du microbiologiste DR Claude Escarguel

                                                                              Résultat de l’exclusion des médecins généralistes : Les cliniques débordent de malades GRAVES ... et pas que depuis hier.

                                                                              Voyons ce que c’est passé les années précédentes à la même période d’année, proche de l’arrivé de l’hiver, dans les hôpitaux françaises !

                                                                              Voyons ce que c’est passé depuis que vous êtes en retraite :
                                                                              Regardez des extraits des séquences vidéos prépositionné par année :
                                                                              2015 - saturation des lits des hôpitaux
                                                                              2016 - saturation des lits des hôpitaux

                                                                              2017 - saturation des lits des hôpitaux
                                                                              2018 - saturation des lits des hôpitaux

                                                                              2019 - saturation des lits des hôpitaux

                                                                            • eau-du-robinet eau-du-robinet 7 février 20:03
                                                                              La liberté de circulation est le droit pour tout individu de se déplacer librement dans un pays, de quitter celui-ci et d’y revenir.
                                                                              Elle est garantie par l’article 13 de la Déclaration universelle des droits de l’homme depuis 1948.
                                                                              En pratique, cette liberté est limitée pour de nombreuses raisons, comme : la nationalité (pour les immigrés clandestins), la propriété (pour les non-propriétaires), la loi (pour les prisonniers).

                                                                            • eau-du-robinet eau-du-robinet 7 février 18:36

                                                                              Dernière vidéo avec l’avocat DR Reiner Fuellmich datent d’hier samedi 06/02/2021).... vidéo en allemand (non traduite pour le moment)
                                                                              BittelTV 06.02.21 Reiner Fuellmich - Corona Ausschuss Nr. 38 - Summary


                                                                                • Emohtaryp Emohtaryp 7 février 20:55

                                                                                  Un peu hors sujet, quoique pas tant que cela !

                                                                                  Un article du Times confirme la fraude électorale massive de Biden sur Trump et le trafic d’influence honteusement poussée à son paroxisme !


                                                                                  Ils ne manquent pas de culot, en gros pour résumer,

                                                                                  oui ils ont fraudé mais c’était pour la « bonne cause » osent-ils dire.... smiley

                                                                                  • eau-du-robinet eau-du-robinet 7 février 21:16

                                                                                    Bonjour Emohtaryp,

                                                                                    +++++ smiley

                                                                                  • eau-du-robinet eau-du-robinet 7 février 21:12
                                                                                    Absolument à écouter ce témoignage frappent :
                                                                                    Un exemple extrait du discours de Martine Wonner devant les parlementaires :

                                                                                    « La société française de pédiatrie nous alerte pourquoi ?
                                                                                    Aujourd’hui ils voient arriver aux urgences pédiatrique / psychiatrique des gamins de 9 ans, 10 ans qui font des tentatives de suicide ! C’est absolument du jamais vue ! »
                                                                                    Martine WONNER - Interventions - Projet de loi prorogation de l’état d’urgence sanitaire 02/02/21

                                                                                    • eau-du-robinet eau-du-robinet 9 février 09:56

                                                                                      L’empire contre attaque !

                                                                                      et c’est l’AFP qui monte au front de la désinformation en publiant cet article


                                                                                      Attention cette vidéo dénonçant une « fraude corona » et des « crimes contre l’humanité » comporte plusieurs fausses informations

                                                                                      AFP et test RT-PCR = FAKE NEWS !

                                                                                      Le jugement d’un tribunal portugais démontré que l’AFP à tout faux et que l’avocat allemand DR Reiner Fuellmich à raison.

                                                                                      Les juges du Portugal soulignent la fiabilité « plus que discutable » des tests COVID-19

                                                                                      En effet, ils citent une étude qui suggère que seulement 3% des tests positifs déclarés par les autorités sanitaires peuvent être de « vrais positifs ».

                                                                                      Une décision de 34 pages sur un appel contre un bref d’habeas corpus déposé par quatre touristes allemands « illégalement confinés » dans un hôtel aux Açores au cours de l’été ne laisse aucun doute sur le fait qu’un test RT-PCR positif ne peut être pris pour argent comptant.

                                                                                      Vous pouvez lire le jugement complet en portugais ici, et traduit en anglais ici. Il y a aussi un bon article sur le Great Game India, et un professeur portugais a envoyé un long e-mail sur l’affaire à Lockdown Scpetics.

                                                                                      • eau-du-robinet eau-du-robinet 10 février 07:59

                                                                                        Même un simple manifestant qui témoigne est désormais censuré !

                                                                                        L’oligarchie ne supporte t’elle plus d’attendre la souffrance du peuple français ?

                                                                                        La dernière vidéo de cet article qui à été supprimé dans la nuit peut être visionnée sur odysee en cliquant sur ce lien

                                                                                        • eau-du-robinet eau-du-robinet 10 février 09:18

                                                                                          Merci à l’équipe d’Agoravox pour avoir remplacé la vidéo censuré sur youtube par celle d’Odysee smiley

                                                                                        • eau-du-robinet eau-du-robinet 10 février 19:26

                                                                                          Vous devez absolument écouter cette vidéo

                                                                                          Arnaud Upinsky au Défi de la vérité

                                                                                          sur Macron !!!

                                                                                          Un extrait de la vidéo :

                                                                                          Au sujet du du Président Macron, vidéo à 12:13
                                                                                          ...Il parle comme des anges, « sauvez de vies quoi qu’il en coute », mais pense comme des assassins, et ça c’est la clé des khmer rouge...

                                                                                          • Emohtaryp Emohtaryp 11 février 18:06


                                                                                            J’ai écouté hier, brillant et excellent raisonnement, oui !!

                                                                                          • eau-du-robinet eau-du-robinet 2 mars 07:56

                                                                                            "Le pire reste à venir, car les « vaccins » ARN dit anti-Covid-19 sont soupçonnés de fragiliser le système immunitaire permettant de créer la base pour le surgissement des vraies pandémies dans un proche avenir."


                                                                                            Une vidéo à regarder entièrement :

                                                                                            Dolores Cahill : biologiste moléculaire et immunologiste


                                                                                            Elle est spécialiste en transfert de la recherche scientifique à l’application aux politiques sanitaires. Elle amène une vision sans concession du coronavirus, expliquant l’attitude « criminelle   » des gouvernements envers leur population avec le confinement alors que des traitements en phase précoce existent (Zinc, Vit.C, Vit.D, Hydroxychloroquine et Ivermectine). Elle évoque sa vision de l’épidémie, les problèmes, la gestion de la crise, les vaccins et les complications liées à la vaccination. 


Ajouter une réaction

Pour réagir, identifiez-vous avec votre login / mot de passe, en haut à droite de cette page

Si vous n'avez pas de login / mot de passe, vous devez vous inscrire ici.



Les thématiques de l'article

